Description :
From Genome Similarity Track
Location :
Scaffold_52:123879- 125951
Sequence
2072 bases(100 bases per row)
TGTGTGAAGCCAGGAGCAGGATCAACGATCGTGTCAGACCAGAGAAGACTGCGGTAGCGCTGAATTTTTCCGTTCAGCTCGCCGGCTCGATGGAGCACGT
GCATCTGCTTCAGGACAGCATTGGCGCCTTACAAATGAATACCGCGCTCGCCAAGGAACTTTATGAAATTTGCTTCTGAATGCAAGCCGAGCTCCAACAC
GTCGTTGCGGTACGTCGGCATTTGCTCGTCCAGTGTGAAGCCTGTCTCGAGAATCAGCTTCAAGAAAGCAGAGATCAGCTTCGGGTCCGACTTCTTCTGC
TTCTCTCCGTTGACGCTCCATAAGCGCGAAGTATGCGCGTACCACTCGAACCACACTGAGTGAAGGTGAGTTAACGACGACTGCTTTCTGTGCTTTGTAG
ATTTGCTGACGTTTCCATCCTCCTCTCAGCACTTGTATTTTTTATTAAGGTCCGCGATTCGTCGAGCTTAGCTTCGAGCGCATCCATGCGATCGTCTTGG
CGTTTTGCATTCTGGATAAAATGATCAATCACAGAAGTTTGGTGGCGACTTATTTTGCGTTCTTCAGACTCTGTGCTTGGCTTGTTCGCTGGTTCTTTTT
CTTCTTCTTCTATATGTACCTATGTACAGGTAGCCGTGGCGAGATGCATGAAACACGCAAGAAAGTCGGCAAGGGTGCTTCCAGACTCCAGTACGCAAGT
TTTCAAGCGCTTTACAGCTGGTCCGTTGGGGGTTGCATCTTTAAGAAGCGGCAAACGTAGAATCGCGTACGCTGTTAGCACGTCGATGACGCGCTGGATG
ACGTTGTACTTCTTTGCGCTGAGGATCTTACAGGTCGCGTAGAGCAGCGCCTGTACCTTGCGTATACTGTCCTGCATCTGAGCGTCGAAGAGCCTTAAGT
CGGCGAGCGAAACGGATTTGTTCGGCTTCTAGCCGCTCAACACCTTCGCAACCTTGTGGTCCTCGTTCATGCTGTTGAATACGTAATAATTTAAACGCTT
TTTTGTCGTGCTTACGTTCCAGGCGCCGCGATCGAAGATTCAACACGCCGCCATTTGCGCGGAGCTGTTCGCGTGCTGCGCACCACACGGCGGAACGAGT
GTGACGTGAGCTTCTGCTCCACTCAAGCTAGAGTGGCGATGCGTTCGAGGAGGCGATTAACGTGGCTGTGGATTGTTGGTGAGATGTCTTTACCTGAGGC
AGCAGCAGATTGGAGGCCGCAGGAAGCCTCCGGGTCGTTGAGAACGTCAAGAAGCGGCGTCTCAGGGAAGAATATGACTGCGGTGTTCACTGGTTGAGCA
GGTAAATTGTCGTGGAGGTCGGCACACGGCGCTGCCTGTGTGATAAGTGCCAGAGCGATGGCGTGCAGCGGTCACGTGGCGAAATTGTCGGTGGGGAAGA
TGGAGATTCCCTGCTCTTCCCTATTTTTTATACGAATGAAGCGTACGAAGAACACGTCGCTCGCATCGATCGAGACATTCTGTTTGCAGACGAGCGTTAA
GTCCGAAGCTTGCCCAAGTATGTATCAATGAAGGCACAGCAAAGCAGCATCCTGGTATTCACTAGACGAGCATGCATTTAAATACAAATAATACATCATC
CGCCTCAAGTCAGTCTTCGTACACGCATTGGCGTTCTTTACAAACCCGCGACCTTCTCTCTTGACACAGTAGTTCTCTAGTGTTCTTCCCATTTTGAGTA
GCCATGAGTCTAGTTTGTCACGCTGCTGTGGGAACTGATCTAGCAACCAATGCTTAGTTTGTCGGTCGTATTGCATCCAAGAATGTCTAGAAAGCGGCTT
GCCAGCTCTGCCTTCGTGAAATGCAAGATTCATAACGAACTTATCCATTACAGACACAAAGCACTGCCCAGATTCCTCTTGCTGAATGTAGCCCTTGATA
TACTCTAGATTTGCATTCTCAGAGTGTAGAAACCGCAAGAATGCCTTCAAAGCAGTTGCTATGGCTCGCTTGAAGTTTCCAGACTGCAGATCGGCTAAAC
TCATTTGAAGTCCGACAGCACGCAATATGCAAATGATACACCCTTGACTTGGGGATTGTATTGACATACAAA