Description :
From Genome Similarity Track
Location :
Scaffold_52:123877- 127147
Sequence
3270 bases(100 bases per row)
CTTGTGTGAAGCCAGGAGCAGGATCAACGATCGTGTCAGACCAGAGAAGACTGCGGTAGCGCTGAATTTTTCCGTTCAGCTCGCCGGCTCGATGGAGCAC
GTGCATCTGCTTCAGGACAGCATTGGCGCCTTACAAATGAATACCGCGCTCGCCAAGGAACTTTATGAAATTTGCTTCTGAATGCAAGCCGAGCTCCAAC
ACGTCGTTGCGGTACGTCGGCATTTGCTCGTCCAGTGTGAAGCCTGTCTCGAGAATCAGCTTCAAGAAAGCAGAGATCAGCTTCGGGTCCGACTTCTTCT
GCTTCTCTCCGTTGACGCTCCATAAGCGCGAAGTATGCGCGTACCACTCGAACCACACTGAGTGAAGGTGAGTTAACGACGACTGCTTTCTGTGCTTTGT
AGATTTGCTGACGTTTCCATCCTCCTCTCAGCACTTGTATTTTTTATTAAGGTCCGCGATTCGTCGAGCTTAGCTTCGAGCGCATCCATGCGATCGTCTT
GGCGTTTTGCATTCTGGATAAAATGATCAATCACAGAAGTTTGGTGGCGACTTATTTTGCGTTCTTCAGACTCTGTGCTTGGCTTGTTCGCTGGTTCTTT
TTCTTCTTCTTCTATATGTACCTATGTACAGGTAGCCGTGGCGAGATGCATGAAACACGCAAGAAAGTCGGCAAGGGTGCTTCCAGACTCCAGTACGCAA
GTTTTCAAGCGCTTTACAGCTGGTCCGTTGGGGGTTGCATCTTTAAGAAGCGGCAAACGTAGAATCGCGTACGCTGTTAGCACGTCGATGACGCGCTGGA
TGACGTTGTACTTCTTTGCGCTGAGGATCTTACAGGTCGCGTAGAGCAGCGCCTGTACCTTGCGTATACTGTCCTGCATCTGAGCGTCGAAGAGCCTTAA
GTCGGCGAGCGAAACGGATTTGTTCGGCTTCTAGCCGCTCAACACCTTCGCAACCTTGTGGTCCTCGTTCATGCTGTTGAATACGTAATAATTTAAACGC
TTTTTTGTCGTGCTTACGTTCCAGGCGCCGCGATCGAAGATTCAACACGCCGCCATTTGCGCGGAGCTGTTCGCGTGCTGCGCACCACACGGCGGAACGA
GTGTGACGTGAGCTTCTGCTCCACTCAAGCTAGAGTGGCGATGCGTTCGAGGAGGCGATTAACGTGGCTGTGGATTGTTGGTGAGATGTCTTTACCTGAG
GCAGCAGCAGATTGGAGGCCGCAGGAAGCCTCCGGGTCGTTGAGAACGTCAAGAAGCGGCGTCTCAGGGAAGAATATGACTGCGGTGTTCACTGGTTGAG
CAGGTAAATTGTCGTGGAGGTCGGCACACGGCGCTGCCTGTGTGATAAGTGCCAGAGCGATGGCGTGCAGCGGTCACGTGGCGAAATTGTCGGTGGGGAA
GATGGAGATTCCCTGCTCTTCCCTATTTTTTATACGAATGAAGCGTACGAAGAACACGTCGCTCGCATCGATCGAGACATTCTGTTTGCAGACGAGCGTT
AAGTCCGAAGCTTGCCCAAGTATGTATCAATGAAGGCACAGCAAAGCAGCATCCTGGTATTCACTAGACGAGCATGCATTTAAATACAAATAATACATCA
TCCGCCTCAAGTCAGTCTTCGTACACGCATTGGCGTTCTTTACAAACCCGCGACCTTCTCTCTTGACACAGTAGTTCTCTAGTGTTCTTCCCATTTTGAG
TAGCCATGAGTCTAGTTTGTCACGCTGCTGTGGGAACTGATCTAGCAACCAATGCTTAGTTTGTCGGTCGTATTGCATCCAAGAATGTCTAGAAAGCGGC
TTGCCAGCTCTGCCTTCGTGAAATGCAAGATTCATAACGAACTTATCCATTACAGACACAAAGCACTGCCCAGATTCCTCTTGCTGAATGTAGCCCTTGA
TATACTCTAGATTTGCATTCTCAGAGTGTAGAAACCGCAAGAATGCCTTCAAAGCAGTTGCTATGGCTCGCTTGAAGTTTCCAGACTGCAGATCGGCTAA
ACTCATTTGAAGTCCGACAGCACGCAATATGCAAATGATACACCCTTGACTTGGGGATTGTATTGACATACAAAACTTTGGCGAGTTTCCAGGCTGCAGA
TAGGCAAAATCATGTGAAGTCGGACAGCACGCAAATATGCTATTGATACACCCGTAACTTAAGTTTTGTATTAACATACACATATCCGGCGTTCTCCTCC
GACCAGACACGTCGGCGCGGCAGGCGTACCCTACTTTCCTACCCCTACACTTTTATATTGGCCAATAACATGTTCATATTCTCTATGATTTGGATATAAA
TACAGTGCTATAATTCCATTCGCTCGTCCGTCGCTTACAAACACTAAGTCATTTTGGAGAAGTGACGATATTCATCCACACAGACCCATCTTCGAATAGC
CACAAGTACTCAACCGACAGCCCGTTGCTCTCAAGTTTCACCTAAATCGCCGACGTCATCTAGCCAGCGAGCAAAAACTTGAAAATGCAGCCGCTCGGTG
GTCTGTCTTCTGCATTATGTACCCCATTAAATCAAATTGTTTGGACATTTCTAGGTCAGACTTGCTACATCCGGTCTCTTCGTCCAGTTTTGCTTCGCTT
AAACGAACTTGACGTAGCTGGCCGAGTAACGTCGTACGTGCGTTGTCTTATCAGACGGAGACGCAGAAGTTAAGGCCTGAACTCTTTTCGTTCGTGCTTT
AGTTGGAGCACCACGTCAGCTCGAGACAACATGTCCAGTACAGATAAACCCTCCAAATTTAGTATGACCCGTGGAACGATCTTGTATCATGTATAACAGG
ATGATCAAATTCTAAAGGTTCAAACACTCTCCAGACATTTTCAGCCCTCAAAAATAGTAAATGAGCCCGGATTCTCATTCAGCAGCTCATTCAAGCACAA
TTCCACGTATAGCATTTCTTCACTCGCCTCCGCAGCGCAAAGACGATGCTGTCGCGACCAAAACAGGTCGGAAACAAGTATGAACAGAAGAAGAAGATTG
CCAGTGCCATGACGCAAACGCCGCTCTCACACAGTCGCAGCTGACAGACAAGGCGAAGCGCGAGTTCGGTCTCTTCAAGGCGCCAGTCCAGTGGACGATA
TCTGGCATTCTTCGTAATCTCCATATTTTTCTGTACATGAAGGACGTCGGCCCCAAGAGCAAGCGAGCCCGAGAGCTCGCGTTCCCTGCAGTCGACGAGG
CCATTGCAAACTGGATGGGGCATTTTCAAGACAAGCGTGCGATGTTGGGCTGTGATCTGATCAAAGCGAG