Description :
From Genome Similarity Track
Location :
Scaffold_26:12381- 13388
Transcript NameFunction/comments
Aphas_H257_10518papain-like cysteine protease C1

Sequence
1007 bases(100 bases per row)
GCGTGGCTGCGTTGGACAGCCGCACGTGCCATCGCACGTGGAAAGGTCGCGAGCATTTGCATCCGAACGTGTACAAGCTGCCGCCCCCCACCGATGACGA
GATGGACGAGATGCGGTCGCTTCCTCGGCATTTGGACTGGTGCGAGCGGGGCATGTGCACCCCGTCGTGGAACCAGCACATCCCGGTCTACTGTGGCTCA
TGCTTTGCGCACGGGGCCCTCGCGTCCGTGAACGACCGCATCAAAATTCTGCACCACGAACTAGGATGGAAGCGCCCGGATGTGATGATTGGGCGCCAGA
GTTTCCTCAACTGCGCGCCAGGGCATGGGTTGTCCCTTGGCTGCAAGGGGGGCGAACCCGCGGATGTGTACGAGTTCATGAAAGTGTATGGCCTGCCGGA
CGAGACGTGCTTGCACTACAACGCGACGGACTATACGAAGTATATCACGGCGTCCAACCCCAATGGCACATGTCCCCCCGAGGGCTTTTGCATCGAGTAG
GATGCCACTATTTCAGTGAAAACAGGACTGATGTCGTTGTTGTAGCTGCATGAAAACCCCCGACAGCCCCGAGACGCCCGTTTGTTTTCCCGTGTCAAGT
ATGGTTCGGTACCGTGCCAAGAAGTATTGGCGCCTCGCGGGCGAACACGCGATGATGAAGGAGCTCCAACATGGCCCCATTACGTGCGGCATGGCCTGTA
CGAATGAGTTTGTGTTCAACTACACGGCAGGGATCTTCCGCGACACCACCAACTTTACCGAGTTGGACCACGACGTGGAGATTGTGGGGTATGGCGAAGA
CGAGCACGGGGTCAAGTACTGGCGCGCGCGCAATTCGTGGGGCACGTAAGTTCCCCCTACTTGCATGGTGCTACTTGATGCAACAGAGATGCTATAGGTA
TTGGGGGGAGAGTGGGTTTTTCAAGATTGTGCGGGGGGAGAACAACTTGGTGATTGAAAGCGACTGCCACGTCATGGTGCCGGACGTGTCGGACGACAAG
TTTGTGT