Description :
From Genome Similarity Track
Location :
Scaffold_2330:1238- 2509
Sequence
1271 bases(100 bases per row)
CCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAGTAGCTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAG
TACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGT
TCCAGCTCGTACGCAAACTCTCCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCA
TGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTTCGCCGAGTG
TTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCT
TTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGAGATGACGACAT
TGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGATAGAACGGTGTTTTTTTTCCTTGTAGTGTCCTGAGAAGTATTAATAGCAAACACCAGCTT
CTCTACGATTTCATCCCAATCTTGCTGTAAAGGGTCTTCCGCGTACACCCGTACGGAACCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCC
TGTGGTCGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCACGGTCGTGCCTTA
TCAGTGATGGGGCTCCGAACCGTCGGTACACAGATTCTTCGAACACTTGGGCCACACTCAGTGCAGTCGTATCCGACATAGCCTTGTCAATAACGAATGT
TCTGAGCGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTC
GGCTAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACAGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTAC
AAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAG