Description :
From Genome Similarity Track
Location :
Scaffold_536:1238- 2241
Transcript NameFunction/comments
g14585.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CACCGCGGTTTTGTGCGATAGTGGAAGCCATTCACAGAGGAACAACAGTTCGCTTCATGGCCAACGGAGACCTCTCCAGGCCGGTAATGGTAACCAGCGG
GATACGGCAAGGGTGCCCGCTGGCACCGTTGCTGTTTGTAATTGCTGTGGACCTATTGTATACGGAGATCGAACAAGCACCAGAGCTACAAGGAATACCC
ATGGGTAAGGACGAGCGAGCGAGCAACCTGATCGTGGCAGGATACGCTGACGATACAGCGATATACTTACAGCACCGTAGAATGCAAAAGGCCGCCATCC
AAGCGGTTGGCAGGTTTTCAGCGGTGTCCGGACTAAAGCTCAACGTTGCAAAGTCATCAGCGATAGTTTTAGGGCCCGGCGGCGAACAACAGCAGGACAT
CCACACGGAGGCCAACGAGGCGGCGGACGACAAAAAAGAAGAGGATCGGGAGCAAGAAGTGGCAGTAACGGAGGAAGTCAGGTACCTAGGGCACATCGCG
GGGCCGAGAGACACCACGGAAGTGGCTTGGAAGAAGGCATACGGAACGTTAACCGTGCGGCTGGCGTTAGCGGAGCTTAAGACCAACACGGTGGCTCAAC
GGGCACTGATCGCCGCTGCGGTCATCGTGCCAAAGCTACTCTATGTGGCACGAAATGCGTGGCCCACGGACGACATCATCAAGGTGGCAGACTTAAGAAT
ACGAAACTTCGTGTGGCACGCATCTTTTGCAGCCCCGGAGAGTGCACCCATAGGGTGGGTCAAGCGAGAGCTAGCCGAACAGCCCACGAGTAATGGCGGA
GTGGGTATACCCAGCATTCAGACAGAGTTGCTAGCGATGAGCGCGACGATGGTCGGAAAGTGGGGCTTATCGCAGAACCCGCAGATTCAATGAGTGGGGG
AGATCTTGCAATCACGAGCAGCAGTAGAGGCAAAGCATCTGGAGTCGTCCACCAACAGACCCACAGGCAACATCGGGAAGTTGAGCTGGGTAACAGGACG
GAA