Description :
From Genome Similarity Track
Location :
Scaffold_121:123798- 130733
Transcript NameFunction/comments
Aphin_H310_11182callose synthase, putative

Sequence
6935 bases(100 bases per row)
TGGTGGCGACGATGGCGCTCAAACGCGCCGGAAGCAACTACTTCCTGCTCGAAAGCGATTACAAGCGGTCCAATGGAGCCCTCAAGCACTCGACTAGTTC
GTTCCGGGATCGCCTCAACCAGATGGACATCCTTGGGGAAAGTGCGTACTATGTCATGGGCGACAACCCGAACGATCCAGATGTGTACAACTCCCTCGAA
TGCGACCAGAGCGGCGGCGCCGAGGTTATCATTGGGGACTTTCCTGACGAAGCATCGATCGATTACTGCTGCGACGTCTTGTATCGCAAATTCGGCTTTC
AGCTCGGGTCAGTCGACAACCAACGTGAGCACGCATTGCTTTTGTTAGCGAATGCCAAGTCCCGCGAGCGCATGAATGGAGGAATGGACCATGTTTCGCT
TCTTCACCGTAAACTGGTGGGGAATTATGCAGAGTGGTGCAAGTTCATCAAGGCTGAGCCCGTGTGGTACGCTGGCGAGTTGAACAAGCGCCTGACGAAC
CGGTTGCACATGGAGCTCATGCTATACTTGTGCATTTGGGGCGAAGCCGCCAACGTTCGACACATGCCCGAGTGCATTTGCTTTTTGTACCATCAAATGA
TGCAGCTGTTGAACGCCGACCTCCAGGTCATGCAGCCATATCCCGAGCGATGGTACTTGGACTCGGTGATTCGCCCAATCTGGACAGAGTGCTCTGGAAT
GACGAAGAAAGACGCGTTGGGCAAGCATCTCGAACACACCAAGGTTCGTAACTACGACGACTTCAACGAGTTTTTTTGGCGAGAGGAGTGCTTGGCGGTG
CCGGTGGACCAGGCTGGCTCCAAGTTGAAAACTCATGAAAAAACGTACTACGAGCATCGGAGCATCATGACCCTTGTGCTCAACTACTACCGGATCTTCC
ATTTCAACTTTATGTTCATCTTCATTTTGGCCGTGCTCCAGTACTGCGTCACAATCTCCCCCCGCGGCGGCGAAAGCGGTTTCATGCAATTTGCCGCGCT
CGGTCAGGTCGTCGAGCCGTACTCAAAGACCGATCTCAAGCTCGCGCTTGTGTTCCTCGTGCTCGCGCATGCGGTGCTGAGCCTGTTGAAAGGCGTATTG
GAACTGGCCCAGTCGTGGCATCACTTCTTCACGCCCAATGACACACCAGTCGACTCCACCGCCCGATCTTCGTCGCGGCTCTCGTACGGATCGGCCCTCG
CTCTGCGACTCGTGTGGAACGGAACGTTTGCCGTCTTGTTCTACGTCATGATGGCGGAAGGATCAGGCGTGAATGCGGCGCACCCGTGGCTGAATCGTTT
TGTGTTGTTGGGACCGTTGTTCCTCGGCCCGGGATTGATCGCGCTGGCCGTGACGGCAGTCTCCCCCGCCATCGTTCGTACGTCGTTTTGGAGCAAATTT
GTCCGAGAAGGCGACACGTGCTACGTCGGCCGCAACATGACGCCGCCGTGGTCGTACCGAGTCGTGTACATTTCGTTCTGGCTCATTCTGTGGCTGTGCA
AGGCGTGTGTGTCGTACTGGGTACTCATATCGCCGCTCATGCTGCCATCCCTCGCCATCTACGACATGCAGCTCGACTACAAGACGCACGTTGTGTCCGT
GCGCAACATTGGCATCATCGCCGCGCTATGGGCGCCCGTCTTTTTCGTCTTTTGCTACGACACGCAAATTTACTTTACGATTTTCCAAGCCATCTATGGT
GCAGTCAAAGGCATGCGCATGCACACGGGCGAGTACCATGGCTTTGCCGATATCAGCCGCGCGTTCCGGTTGATTCCCCAGCACTTCGACAGCAAAGTCG
TCACAGCCTGTGCGGTACGTTAGGTTGGTGTCTCATGGCTCCTTTGTGTTTGCTGGCCTATTGTTGCATGGGGTGTTTGAGCACTGAGAACTTTGAATGG
GAGACCAGCAGCCGTACAGACCACGCGTCGAGAGGAGGGACCGGCTTTGAAGGCGGCAATGCATGCCGTTGGATAGGTGACCGACAGCGTTGTGGCCGTG
CAGTGTTATTTTGACATTTCGTGTTGAAGTGGCGACTGGGTGCACGTGGTTGATGTGGTGAGATGATGCGGACTCGGTTGTCGCTGTAGGTGGCCCAAGA
TCACGTCCCGTCCGAGGACGGCCACCGCCGGTCCATGCTCATGGCTCGTTTTGTGGTGGTGTGGAACGAAGTGATCAACTTTTTCCGGGAAGGCGACTTG
CTCGACGACAAGGAAGCTGCGATTCTCCAATACGACGTGTCGGAGCAAACGGGCGAAATCTATGAGCCTGTGTTCTTGTCTGCAGGGAAAGTCCAGGAAG
CGATAGCAAGTGTCCTCAAGATTGACCGGAAGAAGAATCCCGGCCGTGATGCCGAATTGAGCGTCGAACTGCTCCTGCATGACTGCAATTCGGCGCTCAA
GTCGTGCTTTAACGCGGTGTTGGTCGTGCTCGAACAGATGCTCGATCCGCGCGACGTGAGTGTGCTGGAAGCATTCGACCTCATGGAACAGCTCGCCGCC
CAGAACAAATTCATGGCGTCGTTCCAGACCCAGCACATTCCTCTCGTCCGCGACACACTCATCGAGTTCCTGGAAGCCGTGCTCGACCTCCCGGCGCCGA
CTACGCCCCATCCCCTCGCGCAGTCCACGAAAGCCCACCCGATGCCGATCGTCCAAGAATTCGTCAAGCGGTTTAGTGCGTTCCTCCATGCAACGACGTT
GTTATGCGCCGGCCAGCAAGTCATTATTGAGAAACTCAGCTCGAGCCACTTTTGCTCGCCCACGAACGGGTACATGGCGGCGGCCGAAGGCCTCGTCAAC
TTGTGCTCGAATGAATCGACGATGGCGAATGCGACGCGCGCGCTGCTACTCTTGACGCTAGACACATCCGAGGCGATGCCGCGGTGCTCGGAAGCAAAGC
GCCGCCTCGGCTTTTTCATGAAATCGCTCATGATGGACATTCCCCAGTTGTCAGCGGTGAAAGAGATGCGGTCGTTCTCGGTCATGACGCCGTTTTATGC
CGAGGGCGTGTTGTATTCGCTGGAGGAACTGAACGCGCCGCTGGAGAACCACCCGATTTTCGGCGCAGTCGAAGAAACCGGAAAGAACCTCACGATTCTG
AAGTACCTTATCACAATCCACACGGCCGAGTGGGAGAACTTTCTCGAGCGCATCAATGTCCAAACGGAAGCCGATGCGCTTCGCGACCACCCCCTTGAAC
TCCGGCTGTGGGCGTCTTACCGCGGCCAGACGCTCGCTCGCACCGTCCAGGGCATGATGCTGTACGAAGATGCGATCAAGATGCTATATTGGCTCGAAAT
TGGATCCGCCAACGACAAATCACAGGAGACCAAGCGCCAGCTCCTCGAAGATATGGTGTGCCTCAAGTTTTCGTACATTTGCGCGTGCCAAGTGTACGGC
AAACACAAGGCGGAAGGCAAGGCGCAGGCGACCGACATTGACTACCTTCTCCGAACATATCCGAACCTCCGCGTCGCATTTGTCGATTCGGCCAAAGTCG
GCAGCCAAACAACGTTCTCGTCCGTCTTGATCAAGAGCGAAGGCGACGAAATCGTTGAAGTCTACCGCTACGACCTTCCTGGCGACCCCATTCTCGGGGA
AGGCAAGCCTGAGAACCAGAACAACGCGCTTCCATTCACGCGCGGCGAGTTCCTCCAAACGATCGACATGAACCAGCAACACTACTACGAGGAGTGCCTC
AAAATGCCCAATCTGCTCGTCACGGCCGACCAGCACCCGTCCGGCAAACCCGTGAGTATCATCGGCATGCGCGAGCATATCTTTACCGGGAACGCGTCGT
CGTTGTCCAAGTTCAAGTCGTGGCAGGAGCTTGTGTTTGTCACGTTGAGCCAGCGCGTGCTCGCCGACCCGCTCTACTGCCGCATGCACTACGGCCACCC
CGACGTGTTTGATAAAGTGATGTGTCTGACGCGTGGCGGCGTGTCCAAGGCGTCCAAGGGGATCAACTTGAGCGAAGACGTGTTTGCAGGGTTCAACACG
ACCCTGCGCGGCGGCGTCGTCACCCACGTCGAGTTTATGCAGTGCGGCAAGGGCCGCGACGTTGCGCTGTCCCAGATATCCATGTTTGAAGGCAAGTTGG
CCAACGGCGCCGGGGAGACGTGTCTCGCCCGCGAAGCGCATCGCATGGGCGCGTTCCTCGATTTCTTTCGGCTCAACTCCATGTATTACTCGCACACGGG
GTTTTACTTTGCCACGTGGCTCACGATCGTGACAGCGTTTGTCTTTATGTACACCAAGGTACTCGAGACCTTTCATGTGGACAACCTCGTCACGGGCACA
TGTGTAGCTTTACATTGCGTTGACGGGCGTCCAAGAACAGATTGTGTTTTCCATGAACTCGACGACCCTGATCTCCAAGAATTCGGACAAAGGCTTTGAT
GCGCGCGCGTTTCGCAACCTGGACAACATTGTCAACACGCAGTACTACATCCAAGCCGGTCTCTTCCTCACGCTGCCGCTGATCGCAGTCTACTTTACAG
AGGCCGGGATCCGCCGTGGGTTCCTCCGCTTCTTCAACATGATCCTGACGGGCGGGTGGGCGTTCTTTACGTTCCAAGTCGGCACAACGACGCACTACTT
TGACCTGAACATCGTGCACGGGTTTGCCAAGTACCAAGCGACCGGGCGCGGGTTCAAGATCACGCGGGAGACGTTTGTGCTTTTGTACAAGGCGTACTCG
GGGTCGCACTACCGCAAAGCGATGGAGCTGATCGGTCTGTGTGTCATCTACGGCACGTACGGGATGTTTTCGATCTGCCAAAAGACGGGTGTGAGCGACT
CGAATACGTTTGGCCAACAGTTTTGCATCACAGCTCAAGGATTCGGCACGCAAACGTTTGCAATCTGGTTCATCTCGGCGTTGTGGCTCCTCGCGCCGTT
CCTGTTCAACTCGGACGGGTTCGACTATGTAAAGACGAAAGTCGACATCCAGAGCTGGGCCAAGTGGATGTACACAGCCAAGGACGACAAGACGGACCCG
GACAAGGTCAACCAAGGTGGGTGGATCGGGTGGTGGCAAGGCGAGGTCGACCAGTACGTCGGCGCCAAGGGCATCTCCCGGGTCACTGTCATGGTGCGCG
AGTGCCGCCACTTGATCGTGGCATGGTATGTCATCACGCTGCGGTACGACCCGATCGTGGTCCTCTACACGAGCCTCGGCGTCCTGGCCACTCTAGGTCT
CTTCCACGCGTTCTCGTGCTTCAACGGCCTCGGCGCTTCTCCATCGATCCGCGCCACAACCTACTTTTTGCTCGTCGCGCTCTTCCTGTCCGTGTACTTC
ATCCTGACGATGATCGCGTTGTCCAAGTCGACCGGCGACGCGTTTGCCATCCTGTACGGGTACTTTGCCATCTTGTACGCGATCAACGAAATGGCGCGTG
TGTGGGTGTACCCGACGTGGAGCATCTCAAACATTGGACTGTTCCAGCAGCTTGCGTTCTTCTTTGACTTTGTCTTTGGGGTTGCCATGCTCATCCCGCT
CATGCTTCTCTCCGTCATTCCGTTCATGAACATCATCCAGACCCGCATGATGTACAACGAAGGGTTTTCCCAAGTCATGTCCGACTCGTCCCAGTACGCA
TTCTCGATCGCTGGCATGGTTGGCCTCGTCGGCGCCGGCGCGTGCGGCTGGCTCCACTACGTCCTCACGACCCTTGACTTGTCCGCGTCGTTCCTCGCGT
ACACGACGTTTTATAACATCACGATCAACCCCGTTGGGTACACGGCGTACTATGCAACGTACGGCACAATCGGCGGGTCGCTCGTGTCGGCCGCGTGTGG
GTATTACTTTGGCCGCCGCGCGACCATCTTGTGCGGAGGATTGGTTTCGTTTGTGTCGATGACCCTCCTGTCCGGGACGCCGACGTTTGGCGGAAACGTG
TTCATTCCGGCGCTGGTGCTGTTCAGCGCCGCGATCGGGATCCTCCTTCCGGCGTTTTGCATCTACTGCTACGAGATCTCGACAAAGGATATGCGGCCCA
AGATCATGCTCGTCCTCGCGCTCGGGTACATCCTCGGGTCGATGGCCGCCAGCTACTACACCCATAGCAACTCGCTCGTGTGGATGTGGCAATGTTTTTG
GTGTTTCATGGTGCTCGCGTTCCTGACCCCCGTCATCATGCTCCTGCCCGAGAGTCCGTACTGGGTCCTCGCCCGCCAGGGATCTGACGAAGCCGATGCA
TGCTTGAGCTTGCTCCGCCGTCGCACGGACGTCACGGACGAACTGAACGCAATGAAAAAGCACCAAGAGTACAACGTCCCAACCGGCAACTCAGTCTACA
AAGCCATGGTGGGGTTTGGATTGACCGTCGTGCTGTCGCTGTCGCTCCTACCGCTCAACGTGTACGTGGCACGCGTGAGTCTAGGGTACGGTCGGTCGCT
CATGCTGACCAACTGCCTCGCGGTCGAATTTGTATTTGCGCTCTTTTCGTTTGTGTACATTGACAAGTTTGCGCACAAGTTTATCTTGATGGTGACGCTC
GTGCTGAGTGCCGTCGCGGTCGCGTTTGTCGCGGGCCAAGACCGGTTCCAGCTCTTTGGGCAGCCCGATCAAACCCCGCTCGTGATTCTGTTCGTTGTGC
TGTACGCTGTCAAGGGCATGGGCCTTCCAGCGACGCTCTGGGTGGGTTTTATCGGGCTTTTCCGCACGCGCGGCCGGTTCGTATCGATGCCAATCTACTT
TACAACGTTCTTTGGCACCCACCTCGCGACGACGTACATCCGGCTCGAGTCGCCTACGACTCGCAACCCAACGTCCACCGAGTACATTTGGCTCTTTGGC
CTCATGGGTGCCAGCGTTGCTCTCGTATTTGCCATGTTTGGCCTGGCCAAGCGGTCGAACGGCATGCTGTGTACCGTCATGGAAATGACGCACGAACGCG
AAATGGACGAGGCCCGCCAACGCGCCGCGAGCCAC