Description :
From Genome Similarity Track
Location :
Scaffold_63:123757- 131189
Transcript NameFunction/comments
Physo_138404reverse transcriptase

Sequence
7432 bases(100 bases per row)
TTGCCTTTGCCGATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCCCGTGGCTTCCTCGGGCGGGAGTCCAGTCGGCATGC
CGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCAGCGAGAGATCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACGAAGAGGCCGGACCCCTC
GTGGATGAGGACCGCGTCTTCTTCCTCCTGCTCATCCGGTTTTGCCTCGTCGCGTTCCGGCTCGGCGGGTTCTGGTTCGTCGAGTTTCGGCTCGGCGAGT
TTTGACTCAGGCGATTCCTTCATCGCAGCGCTTCCAGCCACTGTCGGAGGCCCATCGGGTTCCACTTCCACCGCCTCCTCGCCCGTTTTCCGCTTGTGGT
CGTCGGGCGGCACCTCTACCCCGCTTCCCTTCGGCGCGCTCGCGACAGCCGCCAACACTGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGCTCCGGG
CGCAAGATGGCTTTAGGCGTCGGGTATGAGGGGCGATTCGTCATCGGCCCGTCGAGCTCGGCTAGGATCCAGTTCTCCTCCGCGTCGCGCATCGCGCCGT
ACGCCAGATTTTGCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGAATCCACGATTCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTTC
ATGCGCGTCGAGGGTTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTACGTTTTCTTTCCGACTCTCCCCTTGCCAAAGGTAGTCACCCACGACTCT
GCCCGTGTCACCCACAGGAACGGCGCGTATCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACGTTGACCG
GGTGCATCCGTGCGCCGTATAGCGGTCATCTGGATATGCACCTCGTCGAGGAGGCACGCCGTGCCATCCGCAGTACTCCAGCGGGCACCATGAAGTTCAT
TCCCAGGATTGCGTGTTGGCCGACCAAGTCGCCGACCCACAGGTGCATGTAGTACACCAAGTTACCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACC
GTGTAATATGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTCTGTGTCGATCAGGCAGCCTACCTCACGAGCAAAGGTGGTGACCAGGATGGACA
CCTCGGCACCTGTGTCGAGCAATAGCACAGCACGGCACTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCA
GTATCCGCGTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCTCGAC
GCGCGTTCTTGCGTGGTACGTTCCAGGTTGGATTTACATGTATTATCATTCAGGGAAGTCGGGCTCTCACAAACCGCCTCTCGCGACTTCTTCGTCACAT
ATGCATAGATGGAAACAGGTCGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCTTAGTTTAACATCTTCTCCGCGGCCGGTGGCAGCATTCCCGCG
TGTTTATTCGGGTCAAACCACTGGCGCAATTGGTTGAAGAACTCCTCAATCGGGCATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCA
ACCATCGCTCCGTCGGGTGCTGGCCACCACACTTCTGACACGTCAACAACTTCCAGCAGTCTCCTTCGACATGGCGACGTGAACCACAGTGGCGGCACCG
CGGGCGGTCGCGTCCCGAGTCGTCGGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGCCTGTCCCGCGACGAAGAACTTGGCGCGTTCTTCGTCC
GCCTCGTCTTGGTCGTACTGGCGATCGTCGCTGTCGCGACTTTCGCGTTCCGAGCCGTACTCGTCCGACGCAACGTGAATCGCATGTACGGCGCGCGCCG
GCGGAGTCGGCGCCTTTTGGCGGAACTTGTTCAAGCCGAAGAGGGTCTTCTTCTGGTGAGCCAATCCACGTTGTCGGGCACGCAGCTTCATCTCCAGCGC
CGCGGAGTCGGCGACCTCCATCAGCGTGAGACGCGAGGCGAGTTCGGCTTCCTGCGTGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTCTCT
TCAGTCGTGCCCTCGGCGTATGGGATGTTGGCCCTCATGCCCGCGACGCTGAGCCGGTACAAGTAATCCAGAGGGGTCTCGTCGGGGCGCTGAACCGCAT
GGTAGTAGCTACTGGCCATTGACACGCCCTTGCCGCAGTACTGCACCCGGAATTGCTCCATCAGCTCGGTCCACGATTTCTTGACCTTCCTGGACAACTG
GAGATACCATTGGCGCGCAGGGCCGCTCATTAGATCGCTGAACTGCCCGCACACTTCTTCGCCCGTCATCCCGTCGCGCCGCGCGGCGGACTTCAGACGG
TTGAGCCACAGTCTGGATTTCTCTTCGCTGGCGTCCCGTCCCGAGAACTCTTTCAGCTCGGAAGATGCTGAGAGGCGTACGCGGGCGAGGGCTACGCCGC
CGGCTGTCGCCGTCGAGACGGCGGCCGCGGTTCTTGGCACTCCGGTGTCCAAGTCGAACAGGTCATCGGGGTCCTCGTCCGCGTCGCGTCGAGTTCTGGA
CCTCGTCGAAGAACGCAAACTGACCGACTCCATGGCGACATCGGCTGCCTCCTGGGGACGAGCCACCGTGGGTGTGGGATTCGAGGGCGGCTTCGGCCCC
GTCGGAATTGCGGCCGTGTCGGCGCGCGGGGTGGTTATCACTGTCGTCTGCATCAGCCTGATGATAGATTCTCTCAAGGCCTTGGGAAGCACCTCCTCGG
CGGGTTTCGTCACCTCTGTGCGTGTGGGCGCCGCGGATAGCTGCATGATGCGCGGCGGCCGGTTCATGGGCATGCGCTTGGACGACTCGAAACTGCTGTC
GGAGTCCACGCTCGATTGGTATCGAGGTGGAGGCGAAGGCGTGGTCGTCGAAGTCTGGGCTGGACCCGCCGAGGGGCTCGGCGCGTCTCGGCCCGTCGCG
GAACTCGTCGCGTCTTGTTTAACGGATCCGGCGAGAATCGTCAAGGGCTCCTGCACGACGCTAATCGCGCGCAGCCAAGACTTGAGGTCCCAATCGCACA
GCCTCTCCATCTCGAAAGCTCCCAACACGAACCCCGAGTCACGCAGCATCTGGAAGAGAGTCGGCGCGGCGTGGGCGACGCTGGTGAGGTTATCGAAGTC
CGGCGCCACGAAGGGGCCTGTGAAGTTGCTCATCAACATGGACTTAAGGAAGACTAAGATTGGGTCTTGTTCTAGCAGACGGAAGAGCTCCGTGCGCGCC
ACGACGTACCGTACCTCCTCGACGGTGTACTGACGTCCCGTGTCCTTGCCTTGCGCCTTGGACAGCGACTCCTCCGCCGAGTCCGGCGCGCGCAGCTTCT
TTTTCTTCCTCTTGGGCGACTTGCGCTTCGTGGCTGCCTTGGCGGTGGGTTGTTGTTGGTCGTCGGCCTTTGCAGGCTTCCGACCGGTAGGACTGTGACT
TGCGTCGCGGCCCTTCGCGGCTCCCTCGTCGGGAGCCGCATCGGGAACGGCAAACTGTTCTTCGTAGCCCTCCTGGTCGTCGCTAGCCCCGTGGCCTGTC
GTGAAGGTTCCCTCAGAGCTCCACGACGCGACAGGTCTCTCCCTGTGTTCTCTTGCGGTCGGCGACCTTCCAGCCGACTGCGCACCTGCCTCCGATGCCT
CTTGGATCGTTGGCCCGTCATTCGAAGTAGTACTCCCGGGTCGCGGCACCATTGTGGAGTAGCGCCCTTGCAGAAATCTCGCGAATGCGATCTCGCACAA
ACTCGGCGCGTCTGGATAGCGGTCGCGCCGAGCGAATTATTCTCGGTTGTTGGAGTAGAGTATCTTCGAAATACAGGCCCAAGTCTTCGCAGGCTTCGGA
GTTGGAGGGGGGGGTTCTTGTGTTGACGCTTGTTCCTTGTCGTAGGGCGTCGAGCCTTGGGCGTGCGGCGTTATCGGGCCGGCGTTTCCTCGGCGTTCCC
GTCAGGCGTGCGGCGTTATCGGGCCGGCGTTTCCTGGGGCTTGTGTGGCGTTATCGGGCCTACACGGGGGGCTTGTGCACAGCGGTTATCAGGCCAGTGC
GGTCCTTCGCCTAGGCAGCGCGTTATCGGGCGCCCACCTAAACGGTATACGTTTAACGTGCCTTTGTTCCAGCACGGGTCTGTGGGGGGTGAACACCCGA
ACCAGCAAACGACGGGGGGCCGGGATATCGAGGCGGCTCTACTTGCCGGCGCTTGGTGGTTCCCCTGGAACCTCGGAGAAGACGGGAGGTCTTTGTGGTT
CAGAGAAATTTCGGGACTGAGTCCTTACCCTATCCTATGTCCTTGCTACTGGCTACTCTGTACTACTGCTTGCTAAGCCTACCGCTCTGGGCCTATCCCT
ACTTCTGTCGTGCTTGCACTGCCGTCCTTCAACCTGGTTTGCGTGGCGCAATCAAGATCTTACCTCGGCGCGTTTTGGTCGGCGGGGGTTAGGGTCGGCG
CGTTTTGCAGAACCGGGTGCGCTGGTCGACCCGTCGGATGACTACGCGTCGCACTGGATTCTGGCACCGTGTCTCACGGCCCATCACCCACGTCGACTTT
CCCGTCGAGCTCGGCCCTGCGTCGCGCCCATCAATCCGCGTCGCGTTCCATCAGCCGCGTCGAAGTCCATTACTCGCGTCCCGGCGCCTTCTTCCTCCGG
CGCCCGGCGCGCCCACTTCTTCCGCGGGGTACTACACCACAGTGAAACTGGATGGTCAGTGTGTCAATCCCAGCGCGATACATGTGCGTCGCCCCTCCTG
CTTTTAGGGAGTGGGCACTGTAAGAGCTGGGGTTGCTACCGGACTGAGCCGCCGCCCGTTGAATTGCCTTGGACAGGGTTGCGGAATATACGCACTCTGG
AATGCCGTCCTTGTTCAGGTACACGGCTGCAGAAATGTTGTGCGGCAGTGACCTTCTTGCGTTGACAAGGCACAATGCTCCGAATACGGGACACACGAGG
CGGTGTCCGGAGCGGTTTAGCATCCGTAGTGTTGGCTCGCCGCGCTGTTTTGTCTTAGAACCGGTGAGGCGGATGTGTACAGACGCCGCTGTCCTTGGGG
ATACCGACGGTGTGCCGCTATCGTCGAGAATAGCGATATCTTCGGCTTTCAGTGCGAACCACGCGAAGTTCCCCTTGTTGAGCGAAGCGATCTCGGATCG
ACGAAGCAGAAAGAAGAAGGCCAGACATATGACCCCCCAGAGAGCTTGATCTGAAGGTCGCACCAGGTTGAGTGTTTGAAAGCACAATTCAAGCTGGTGG
ATGGAGACGGGAGCCTTGTGCTGGACGGGAGTGTCGAGGCGACCGATGCCCTTCAGAAGCATGCGAATGTGTGGATGGCCACAAGGGAAATCGGACCCAG
CAGCCACGAAGAAGTGACGAATGCCGGACAGCGTTGCCGAGATGGTCGAGCTACGCACGGGATGGCCCGCGCCGTAGCCTTCGCGAAAACCCCGCAGAAC
AAAGTCGGTGATGTGTTGGACGCTGGCTGATAGCGTCTCGTTCTCGAAGGTTGGGGAGATGCCGCTGCGCTCGCACCAACTAAACCACTTGCGTAGCGAC
TTGAGGTACTGATCATAGGTAGTTACAGGGACGGAGTGGGCTCGGAGATGGAACGCCAGATCGTCTCCAGATCGGACGAAGATATGGTGGCTTGAAGCTG
CGACCAACCAGGAGTCAGAGGCGCAAATATGTTAGCACTCAAAGAATTGTTAGACATGCGTGAGCCCGCGTCCGCGACAGTGTTGTCCACCCCGGCGATG
TGTGATGACGAGAACCGTAGATTGTGCTCCACTTCCCATAGCGAAAGCAGTCGAATGACCGTCTGAGCACGGCGGTTGCCGGAGGCCAGCTTGGATTGCC
AACTTACTGCCGACGTATTATCGATGCGGAAGTGTACGTGTAGCGGGATTCCGGTGTTTGTGGTCTGACTGCGCGCTGCCCACGATGAACCCCATGTGTG
AACCGCGAACGCACAAGATAGAATCTCCCGGTAGTTAATGTCAAACCCGACGGCGGGTACATTCTTGGTCTCCTCTATCAGCTTCCGCTCGATCTCGTTG
CACTGGTACGTCAGCGCGCGCTTCTCAGCACGGATGATGGCGTATAAGCTCGAGTCGGAGGCATCCATCTCGACGATAATACTGGCTTCTGGAAGCATGT
TGAAGTATTCTAGCGGGACGCCGTTGAGTGATGTCGTGGCCAGGATACGAAGCCACCAATGTAGGTCGTCACGCATTTCATTGTTCACCGGAACCGATTG
CCAACGGTGCATGTAGCGTTCGTGCTGCCGCAGGCGTTGCAGGAAGGCTCGGGCCGGGCGGATGCATGTCGCCACGTGACGGAGACTCCCTAACAGCGAA
CGGTATGACGTCCGGCTCATGGAGGTGCATCCAAGAGCAGCACGCACAATACGCTGAGCTTTTGCGACTTTGTCGGCGGGCATCGACACCACCCCAGCGG
CGGAATCGAAAATCAAACCAAGCGCCTTCTGTTTCGTGCACCAACCAGAGAACTTGTCCTCCTTGATAGCGGAAGGGCCAAGGATAGTCAGCATTGCGTG
ACGCAGAGACTGTTCCATGTCCATGCAATTGGACCCCACGTCCGCGGCCACATTGATATGGTCGTCCACCCAATGGTAACTGAAGAAGTCGTCAGGGTTA
AACTTGTTCACCGTGTTGCCGTGGATGAAGGAGATAGCACCGCCCACGACACCATAATTACCCGGTGAACCTGACCAGCCGAAGGCGGCGGACATGTCAA
TGATGAGGGCAGCATCCCGGTGGAGACGTACACCGAAGAGGTGGACACACTGGCTGTGGATACACACATGTCGGTAAGCCGATGACACATCGCCAGCTTG
CTCCTTGACCTCTGCGCCTGGGTGGCGTTTCTTTTCTTGTACAATAGTTGTCGCTACGGCGTCGCAATGTTGATATTTCGGCTGACAGATCGCGGTCCGG
TCAGTGTGGTCGTTGAGAGACACGTTAACCGGGCAGGATAAGTCATGAATGACCCGGCCGGTGGTTTGAGGGTCACCGTTACCTTTGTCCACGACCCCGA
AGGGGCTGATGTGAACTTCTGGCCACAACTCCAGAATGTCTTCGTCGACGACGATGCAGCGCTAGGCATCTTGATCGCGCCGGATGTTTTTGACGAGCAC
ATTGTATCTTTCGTCTGCGGAACGGTGGTTGGGCGGGCGCACGGATTGGCGCGGGAGCGGGCCGGCTAACGGCACCCGCGCACCGGATTCTGCAATGTCA
AGTAGGTGTGGTAGATATTTGTAGTCTCGACA