Description :
From Genome Similarity Track
Location :
Scaffold_121:123741- 125737
Transcript NameFunction/comments
Hyaar_Emoy2810239hypothetical protein

Sequence
1996 bases(100 bases per row)
TTGCAGGTGGTAATAAACCTTATTAGTCACTTGTGCTGTAGCTGTCGAGGAAGCAGGTATGCACGATAGCGACCGATCGTGCCTGCAATTGCAACAATAT
GGACACATTCACTGATTCAGTGGCTGCTATATGCACTTCTTGTTCATTTTCGTCCGAGTCATGCATTTCACTCGGCCTCTTCAATTTGCTTTTTTTCTCG
GTCTCTAGTGCCGCTTGTACGTGGACTTCTCCGCCGTGCTTGATCCATTCGTCGGACTGCTGAGAATGAAATCATCGTGTCGATTCGTAATGTGTCGTTG
CCGTCGTTTACTCTCTATGTGTGTATTTGTATGCCGATAAGTGCCATGTGTTCATGACACTTCCATGCATTTGGCAAGCTACTGCCAGTTGCCCAGAGCT
CTATTCAACCCTCTGCTCCGGAATCCGGTCAAAGCGCCGACTAGTCGAAGCGCCACAGTTCATGCCTTTCGGCGGTCCAATGTGGATAGATCCACGATAA
CTTCCCCCGGCAAAGGTGTTCCGAGGCATGCCAGTTTGCGCCCGCTTCTCACGTGTACAAATGTAGTGTCCAGCAAGTCCATCGGCAGGGATGAGGTATC
CTAGTGTGACAGTACGCCGTGGACCTTCGCGCATGCACGGGAGATCTTTTAACGGCACCACAGGGTCAATCACAAAGCTCTCGTCGTTGGAAATCAGCAC
CAGCTCGATGTTAAACATGCTCGCCACCGCATACAACTCGGCAGTCGTAGCTTGCTCGTCCACTGTGTTTCGAAACGTCTCATACCGCTCTTGCACGTCT
TCCACGTCCTGCATAAGAAAGCCTGCGAACTTCTCAATGTGCTTGAGCGCGTATTCCATCAGCTTTACTCGCAAAAATTGGGCTGCTGCCACTCGTCGAG
GTGCCATTCCATCCGCAGCACCTACGTTCACTACCGTCATACTTGCAGGGTAGTCCCGCAGACACTGCAGCGGATACATCTCGTACACAATGCAGTGCAG
CAAACAAGATCCATCGGGTGGCATTCCGACACCGACAAGTCCCATTTGCACGAGTCGATCCTCCATCTTTGCTCGCTGCATGTCGAGCTCTGGCGTAATA
ACATCCGATGCTGTGACAGCCATCATCGGTCCTCTTGAGACCGACACCATGGACGTTCGTCCAGAGGTACTTGACAAATTTGACGATGCTGGAAACCAGC
TCCCTCTCGACGAGCCAGGACCTGTTGACCCTGCAAAAGAGCCCTGACTGCTCGCAAACGAAGTGCGTCCTCCACCCATATGTGGTTGTGACCCTGAATG
TTTTGCAAAGCTCTGACTGCCAACAAAGCCCGTCCCTGACCAGCGATAGTCACTAGCCATGGACGCAAAAGAAGAGACAGTTGACGTACTCGAGACGGAC
CGAAAATCGTCTTCGTCGTCGCCCTTGACACTGGCCGTGGCTTGCACAACTGCTGACGACGCCAAGATGGACGACGACGGACGGAGATGGGCGTCCTGCT
GGTCATAGTGGGCATTGGCTCCAAAGCCCGAGTTAAACCCCACAAAGTTCTTGAGCGTCTGGCTACTTACTGCAGCCAAGTGAAAAGCCACGAGCTGCGG
TTTGTGCGTCACGACGTTCATGTAATTGTCGAGCTCTCGGGACCGAGCACCAAGGAACTCGAGGCTTTTGTCCGCCCGAAATAGAGCTCGACGACGGTAC
AAAGGCGGGAACTTGACGCCTTTCATGAGCACGGGAGTGCGTTTCCGGAGCTGCTCGTCGAGCTTCCGGAACGTGGAGAAACTGCGCCAAATGTGCCAAC
TCGTGTGCCCTGTCGCATGAGCTCGGGACGAGTAGAACGACAGTTGCACCACGACCTTGTACTCGACCTTTTTGTGACTACTTAAGCGGTACTCTTCCAC
ATTGATCTTGCACGAGTAGTCGCCTTGAATATCGTCAGGGGTCATGGTTAAGTACGCCATTGGAGGAACGATCCAATGGAATGGAATGGAATGCGG