Description :
From Genome Similarity Track
Location :
Scaffold_150:1237- 7569
Transcript NameFunction/comments
g18641.t1hypothetical protein

Sequence
6332 bases(100 bases per row)
TTGTCGCGTCGGACGCCGCGACCCTCTGCTGCCTCAGCAGTCACGTTTCGCGAACGGCCTCCGTGCAACCTTCCTCCTCGCCGAACTCGTCCTCCGCGTT
ATTCGACTCGGCCTCCACGGCGTCCACGCCTCCGCTAGAGCGGTGACGACCGGCGACACTGGCAGCTGCCGCTTCAGCAGCAGCAGACACGTCCTCGCTC
GATTGGTAGCTGCTTGCACGGCTCGTCCGTCGCAGCCTACGGCGCCTCGAAACTCCTCCGCCGCTCCGTCAACAGTACGCTTCAGCGACAGTCTTCCTGC
TCGGCCACAGCCCGCGAACACCAACCTCCACCGCACTCACCAGGTCCGTCACGAACTACAGTCACCGTCGGGCCTCAGACGCGGCCTTCGATCACGACCC
ACCGCATTTGCCTACGGCTGCTTGCCACCTCCGTCGCCGTCTGACGCCGCGACTTCCTCGGCTGCCTCAGCAGTCACGTTCGCACGGCCTCGTGGCCAAC
CCTCCTCGCCGAACTCGTCCTCGCTGATTCCGACTGGCCTCCACGGCCGTCCCACGCCTCGCCTAAGGGGTGACGACGGCGACACTTGGCAGCTGCGCTT
CAGCAGCAGCAAGACACGTCCCTCGTCGAGGGGGTAGCTGTATGCCAACTGTGCTCGTCCGTCGCAGCCGTTCGCGCGCCTCGAACTCCTCCGCCGCCGT
CACATCGCCAGCGACAGCTTCCTGCTCGGCAGCAGCGACACCAGACTCCACCGCACTACCAGGTCGTCACGACTACAGGTCTACCTCTGGGCCTCAGGAC
CTCGGCTTTCCGCACGACGCCACCGCATTTTGCTACGCGCTGCTTGCCACGCTGACCTTCCGTCGCGTCGGGACGCCGCGACTTCCTCCGGCTGCCTCAG
CAGTCACGTTTCGCAACGCGCTCCGTGGCAACCCTCCTCGCCGGAACTCGTCCTCCGCGTTATTCCGACTCTGGCCTCCACGGCGTCCACAGCCTCCGCC
TAGAGCGGTGACGACGGCCGACACTGGCAGCTGCCGTCAGAGCAGCAGACCACGTCCTCGCTCAGAGGGTAGCTGTTGCACGGTGCTCGTCCGTCGCAGC
CGTCGGCGCGGCGAACATCCTCCGCGCCGTCACAGTCGGCTAGCGACTAGCTTCCTGCTCGGCAGCAGCGACACCAGACTCCACGCACTCACCAAGCGTC
CGTCACGACTACATCAGCCTCGGCCTCAGACGCGCGGCTTCCGACAACGACGGCCCACCGCCATTTGCTACCGGCTGCTGCCACCTCCGTCGCGTCGGAC
GCCCGCGCTTCCTCGGGCTTGCCTCAGCAGTCACGTTCGCAACGGCCTCCGTGGCAACCTCACTACGCCGACCGTCCTCCCGCGTATTCCGACTCGCGCC
TCCACGGACCGTCCACAAGCTCCGCATAGAGCGGTGACGACGGCCGACACGTTGGCAGCCTGCGCTTCTAGCAGCCAGCAGACACGTTCCTTCGCTCGAG
GGTAGCTGTTGCAGTGCCCTCGTCCCGTCGCAGCCGGTCGGCGCCTCGAACTTCCTGCCGCCGCCGTCACAGTCGGCCTCCAGCGACACTGCTTCCTGCT
CGGCAGCAGCGACACCAGACTCCACCGCACTCACCAGGTCCGTCACGACTACAGTCACCTCGGCCTCAGACGCGGCTTCCGACACGACGCCCACCACATT
TGCTACGGCTGCTGCCACCTCCGTCGCGTCGGACGCCGCGACTTCCTCGGCTGCCTCAGCAGTCACGTTCGCAACGGCCTCCGTGGCAACCTCCTTGCCG
AACTCGTCCTCCGCGCATTCCGACTCGGCCTCCACGGCGTCCACAGCCTCCGCTAGAGCGGTGACGACGGCGACACTGGCAGCTGCCGCTTCAGCAGCAG
CAGACACGTCCTCGCTCGAGGGTAGCTGTTGCACGTGCTCGTCCGTCGCAGCCGTCGGCGCCTCGAACTCCTCCGCCGCCGTCACAGTCGGCTCAGCGAC
AGCTTCCTGCTCGGCAGCAGCGACACCAGACTCCACCGCACTCACCAGGTCCGTCACGACTACAGTCACCTCGGCCTCAGACGCGGCTTCCGACACGACG
CCCACCGCATTTGCTACGGCTGCTGCCACCTCCGTCGCGTCGGACGCCGCGACTTCCTCGGCTGCCTCAGCAGTCACGTTCGCAACGGCCTCCGTGGCAA
CCTCCTCGCCGAACTCGTCCTCCGCGTATTCCGACTCGGCCTCCACGGCGTCCACAGCCTCCGCTAGAGCGGTGACGACGGCGACACTGGCAGCTGCCGC
TTCAGCAGCAGCAGACACGTCCTCGCTCGAGGGTAGCTGTTGCACGTGCTCGTCCGTCGCAGCCGTCGGCGCCTCGAACTCCTCCGCCGCCGTCACAGTC
GGCTCAGCGACAGCTTCCTGCTCGGCAGCAGCGACACCAGACTCCACCGCACTCACCAGGTCCTCCAGGGTAATAGCAATTTCGGTAACTGGATGTGCTG
GCATGAATTTGTTAAGGGTTCGAGGCGTATCGGTTGATGTGTCAGTATGAGGCTCGGCTTGGGAATCTATACCCGATACGTGTTGAAGTGTGTGGGGGGC
TTCTTGCAGTACTGGTTCGGCAACCTGCGACAGCTCCTCCTTTACTCCGTCTTCTGGAGTGTCAGCCATGTCAACTGCATGCTGGCTGTTGAACATACTC
TCGATCGAGGCTAATGCTGTAGCAGTCATCGAATTGACAACGCTAGCTAGTGCAGTTGCCATCGCATCACTTTCGCTAACTAGCGACTGGTAATACTCCG
TGCTGTCTTCCACTTGAGATGTTCCAAGTACTTCTTCTATAAACTGGATGTCGTTCTTGTATTCACGAGGAAGATCAACGTTTCGTGAAACCTTATCAAC
CGCCTCCATCAACATTGCTTTGACAGAGCGTGCTACAGCAATAGACATTGCTGGTGGCAAACTCCCCTCAAACGCACCGTCGTAGATTGAGCAGTCATTA
TGGCTGTCACTTGTAGCGTCTGTGGTGTGATCATGAATAGACGCACTCAGTGACTCATTTTCCTTCTCGTGTTGTTCGGCTTCTTGTTCTTGGATTGAAT
CCGAAGCAACAGACACCCTTTCTGCGATGTACTCGCTTTCATCTGCGGCGCTTACCGTCGCGAAGCAACTAGGTGGGTCTTGTCCAGCTACAAGTGAAGT
ACCCATATTCATCATAGAGTCGAGTATTTTTTCCACCCCCGCTGCAATGACCGCAGTCACCGTTCGGCTAACAGCAATTGCAGCCATGACGGATACCTCT
TCCGAGTCTTCCTGACTGGAATCGAGCAGTTCGCCAGGTTGCTCGCGCTCGCTTGCATTAGAAAATGCCAATACCGGGATGGAGATAGGAATGCCGTGCA
CAGACTTGCTCAGAGCAAGTGATTCTTCAACAAGGTTGCTGTTCATCAGAGACTCGCCTTCGAGACCTTCTACTCGAGGTTCCAGAGGCATTTGCGCCTG
AGAGGTTCCCATTACGTTTGCTAGCGCAGCTTGGAGAGATAACCCGATCAGACCATTTACAGCTTGCCGAATGGCTAGTGACATCTGAATGGGGAGCGTG
GCAGTATTTTCCTCATCCGACACTTGATCAGAGACAGCCCCCACGCTAGCAGCCAAAGCCTGACCCTCGGTTGGCACTCGCGATGATAATTCTTCCTGTA
ATACCGTGCTCTCCACTATCTGAGAGACTAATTCCCTTACAGTGTGAGCTCCAATTTGAGCCAAAACATTTTCTGTTGTCTGCTCAATGATGTTATTCAC
TGTCTGCCGAATAGCGATCGCCATTCCATTTGATATGTCCTGTGGAATATCAACACCGCCAGATTCTGTAGTATTGAACTCGTCTACAGAGTCACCAAGG
CCCTCAAGTTCGTCAAGCTTACCAGCACTAAGCGCAGGTGTTGGTTCGTTCGCTGGTGTGCCCGTTGGTGGAGTGCTGCGCGTCATACTATCAGAAACTG
CATTCTCGACTGCGACAGCGACCATACCGCTAACTGTCCAACGCACAGCGATTGCCATTTGAATCGATATTCCCTTGGCATCCCTCTCAGACGATTGGTT
ATCGTCGTCTTCCGGGAGATGTAGCTGGTCGAAGGTCTCAATGGCTGTCATGACAGCAGCATGATCATACGGTACGGATTCCACATCATGCTGGTCGTGA
TATTGATCCAAAGTGACCGATCCAAAATGCGGATGTTCTTGGTCGTTGCGGCCCAATGGCGAACTACTCACGCCCGATACACGCGATAGGTCTGTAATCA
CATTTTGTAGAGCCTGCACCAAAATTGCGTTCACACTACGCTGGATCGAAATGGACATGTTCACCGGCAACTCATCAAAGTCTGATGAATCTTCGTCTTG
ATCTCTAGGCCCCTGTTGAGGCGCCTCTCCTGTTCTCACCCTGGCATTTGCGCCGGGCTTAACCGATTCATCAATTCCAAGCGTTGCCAAAGGACGTTCG
TGACCCACTGGAATTTCAGGTGCTATAGTCGGCGCTGGGTTCTCGCGTTCCTGCGTATATCGCACGAGTCGTTCGTCGGCATCCTGTAAACTCTGCACCA
CCGATTCCAAGGTTACAGCAACAACAACCGAAATATTTCGACGAATCGCAGCGGATACTTCATCTGACACGGCATGGTCCGTGTCAAATGCTTTGTCTGC
TGCAAGTTTGACCCCCTGCTGATCATCAGAAACATCCAAGGCAGGAAACTCAGGCAGCAGACCCGAAGCACTATCCTCGTTATCATCGTCGAAATGGGGG
TCGGTTCTGGATGTGTCGTCGTCGTCAGCCTCACTCACTGACTCCAGCTGTGCAGAACAAAGCTGCTTGACCGTTTTCTCGAGTGAAAGTGCGATTATGC
CATCAATATTTCGACTGATAGCAATTATTGTTTGTACAGATAACTCGTCGTCGGCGTTGTTTTCTCGAGGGCTTGTGTCAGCCTGGTCAACCAATCTGTC
GTCATCGTCGGGCTGCCTCATGCCATCACTCACTGACTCCAATTGCGCAGGACAGAGCTGCTTGACCGTTTTCTCGAGTGAAAGTGCGATTATGCCATCA
ATATTTCGACTGATAGCAATTATTGTTTGCACAGACAGCTCGTCGTCGGCGTTATTTTCTCGAGGGCTTGAGTCAGCCTGGTCATCCACTGATTTTTGGT
CTTTCTTCGACCGACTCGTGCCGAACTTGTTCACCTCCAATTCCTGGATAAAATCTTCCGTCCGAGCAATATTGTGCAAATTGACAGACATTACCGTCAG
CTCGCTCAAAGCACCAGCAGGGCTTCTACTTTCTAGCGCACGTTCAACAGAGCTCTGCACGGAAAGCGCGATTAAGCCATTGACGTAGCTGCCAACAGCA
ACCGCTGCTTTTGCAGGTAAAATTGCGTCGTATTCTTCTTCCAGTACATCTTTGTCCATGACTTTCTGGGAATGCTGATCTTCCACCTGTTTGGTTGGCA
TCGCCTCATCATCTCCCTCGAGCTCTGGACCCTCGCCAGTTTGATCCTGCTTTGAAGTTTCAAACTGCTGCATCATGCTAACCAATGACATGGCGATGAT
GCCATTAACGCTGTCTTGAATTGCTTTTGCCATTTGTACAGATACGTGGCCCTCATCATTCCCCGAAGTATCGGAGCGATGAGTCAATTGATCAGTGCTT
GATTCGTTGTTATCAGATGCTCGTGATAGATCAAGAGACGGCACTTCGCTAGCTGCAGCGAGCGGTAGTTGTCCAGTGGGAGGAGTTGCGAAAACATCAC
CGTCTACTCGAATTCTCTGGGCCACCGCTTCAACGGCGATAGCAACAAGTTCGTTCAAGCTCTGGAAGAACTGAGCTCCCCCCTCTCCATCGAGTGGAAG
CGCTCGAAGCTGTTCAACTGCGTTCGTTAAAGATCCTGCAATCGTAGACGCCACGATTCGGCTGATCTTGCCGGAAATATCGTCTGCAGGTGGCTGCACA
CTGTCGTGAACTCCTTGTTGTATCCGAAAGTCGTCATCTTCAACTGCACGGCTGCTCGCCAGTTGGTCCATTGTACTGGTAAGTATCTCCTGGGCTAACA
TGCTTGAAGGAGTCAAAGAATTGACCACGTTTTGAAGGACATCCAGCAGAACGGAGTCTGAAGCTGGCGACTCGCCGATCTTCTCACTTTCTGCCTTTGA
ATCAAAAGCAACGGTATCATCATTGTTGTCTGTAGGTAGCTGAGAACGTGACAGTTGTGGTGATGGTTTTTCCAATTCAGTACAAACCCCATCATCGACA
GAGAACGTACTGTCGTACGACAATAAGGTATA