Description :
From Genome Similarity Track
Location :
Scaffold_1539:1237- 2906
Transcript NameFunction/comments
Phyag_g10910hypothetical protein PHYSODRAFT_515318

Sequence
1669 bases(100 bases per row)
GATTCTGAACAATGTTTGGGGACGATCGGGCCCCGGAGACCTCACAGCTATCATCGGGCCGTCTGGAGCTGGTAAAACAACACTTCTCGATATTTTAGCT
GATCGTGTGACGAATGGAGGCCCTGGTGTGCGTATCGAAGGGATTATCGATGTGAACGGGCAACCTCGAGATCCACGCACTTTTCACTCCATCATGAACT
ACGTTTCCCAAGACATGGCATTTCTCGGGTCATTTTCAGTTCTGGAAACTCTTCAAATTGCTGCAGGACTCGGTCTACCGGGTCACGTTCCGCCGTTAAC
TCGCGAATCGCGTGTCCAAGACGTGATCGATGCCATGGGGCTGCGTGCTTGCATGTACGCTAATGTCGGAGATGTTTTCCACAAAGGAATCTCTTCGGGA
CAACGTAAACGACTGGGGATCGCCGTTGAACTGCTCTCAGATCCAGCATTACTTCTGCTCGACGAACCAACCTCAGGACTTGACGCTTCCTCTGCTCGCA
GCGTCATGCAGCACATCGAGCGTCTCTGTCATGAAGAAGGCAAGAACGTCATCTGCACGATTCACCAGCCATCGTCTTCCGTCTTCGAAATGCTCACAAA
TTTAATCATCTTGAGCGACGGCAAGCTCGTGTACTTTGGTGCGGCAGGCTCAGCACTCGCGCACTTCGTCAACATGGGCTACGTTTGTCCCATGTACTCA
AATCCAGCCGAATACTTCGTGCACTTGGTGAATGTGGACTTTCATCCCAATATGCGACTGGAGCCTTTTGTTCGAGCACTCGAAGAAGGATCGGAACCAC
AGCGATTGAAAGTCGATATAGCTCGAGATCGGGCGATGAAAGACACGAACCTCGTCAACTACGCTCTGCTGCGAGCTATGCAGCCATCTAGAGTCGACCA
GTTTTGTGTACTGCTGCACCGGAACTTGTCCAACAATTGGCGTCACCCGGGCGTGTTCTGGCTACGTGTACTCATGTACATTTTGCTATCGTTCATGGTT
GGTACGATGTATTTGAGTTCCAACCAAGGCATCACGAGCTCCGCGATGGTCCCGCTGTTGTTCTACGTCCAGGCTTTCTTGGTTTTCATGTCGGTCGCAG
CATTACCGGCATTGCTGGAACAACGAGCTGTGCTGGAGCGAGAAGTGCGTTCGCATTCGTTGCATTTAGCGAGTTACACAACCGCTAACCTGCTTGGCGC
GCTACCTGGTATCATGTTCATCTCATCGCTGGCGTCTTGTATCGTCGTCTACTTCGCGCATGTGCACTCGTTTGGTACATTTTTCCTGAACTTGACGCTG
TCGCTCATCACGTCCGAGTCGATGATGCAtttgcttggtgctgcagtgccgCATTACATCATGGGGATCGCGTTGGGGGCTGGTCTCTTCGGTATGTTCA
TGCTGTGTGAAGGTTTCATGGTGCCGTTCGCCGCAATCCCGGTGTACTGGAAATGGGGCTACTACCTGGCCTTCCACACGTACTCGTTCGAGTCCTTCAT
GTACGAACATTTCTCCAGGGAGAACACAAAAGAGGCCTGGGACATACTCAAAAGCTACGGCATGGAGAAGGTCGACGTATCTCGCAATATGGTCATTCTC
GTAGGGTATGCAGCTGTTCTACAAGTCCTAGGCATCGTAGTGCTGTTTGTACGCTTCGGTCGCCACCGA