Description :
From Genome Similarity Track
Location :
Scaffold_6:1236770- 1248588
Transcript NameFunction/comments
Aphas_H257_04334dynein heavy chain

Sequence
11818 bases(100 bases per row)
CTTGCCGACCGGCCTACGTATCCAACATACACAGCATGGCACAGCCGCGTCGAATCCAATGGTCCGGCGCTTGCTTGGTGGGGATGTCTAGCGCTACGAC
AAAGTTGGTCGAGTGGCCAGTGGTCGACAGCGTCCCTGCCCGCGTCGACGTCTTGTACAGCGGACACTCGTACACTCCTTTGGGCTTGTACTCGATGCTG
CGCATGGGTTTCAGCCACACGATGGGCATCCGGTCAAAAAGGTCGCCGGGGGTCGACTCGCCGATCCGCATGGTCGTCCGGTCGAAGCGCGCGCCTTCCA
TAAACAGCCCCGAGATGTAACACCCAAACGCCGGCGGTCCTGTGACACCGTCGACGCCGTGCGACAGCACCTCGCATGTGACGATGAGCGCGTCGATGGC
GATCTCATGTTCGCGGGAATACACTTGCTTGACGGCAGTCATAAATCCCTGGGGAAAGAAGAACCCTGGCAGCCAGTATGACTGCGGGGGGCCATCCACT
AACCACGTGTGTATCGCGTCGAGTCGCCGGAAAAAGTCTTCGACCCACGAACTCAGCGGCTTGAGGCACGGATACCCCGCGTCCTCCCACTCCTTGGGGA
TTTTCTGCAGAAGGAACCCCGTGTACATGCGCTCGAGTGCCCCCGACATGACCACGAGCCCCTTGATCGCGCGCTTGAGGTTCTCCAGTGTTGTGTTCAT
CACGTGCATCAAACCATTGAACCGGATCATTTCTTGGCCGAGAAACACACCGAGTGAGTTGCGGCTACCGCTTGTCTCTTTGAAACTGTCGGCATGGCCG
CGGGCTTCGTCAAACATGTCGGGCATCCGGTCCTGGATGTACACCACGAGTTCCATCACAACTGCGTCGTTGTCGCTCGCGTCTCCGCCACTTCCGCCGC
CGCCGCCGCCCCCCAGCATGAGCAGCATCGTCGAGATCAACTGACTCGTCTCTTTTTGCTGGAACGTAATGTCGGCGTTCGCGTGCAGGCCAAAGATATC
TGGCGCGTCGACCAACGGCAAACTCGTCACGTACCTTCTTGTGTCTTCCAACGATCCCGTCGCCGGGGCAAAGTACGTGTTGGACGTGGCAAAGCGATAC
GCGTCGTCGAGGAGGTTCTCGTGGAACAGCTTGCGCATGATGGACGAGTTGGTCCGCTTATCCCATCGGTCGGTGATGCGGCCGCCGTACGTGATGTCGG
CCACCATCACGTTGAGTGTCACGAACGGCACCTCGTCCTGCTCCTCCAGGTACAGCTTGACTTGCTGCATGCCGGTCTTCAGGTCCGAGTTCATCCACTC
GTACGGGATGTTCCACCCCACGGCGCCAAACTTGCGCCGCTCCAAGCACAGTGCATTGTAGAACGCCAGCGCGAAAATGAACTTTTTATACTCACGGGGC
TTGGAGCACCCCTCAAAGTCCACGTCCTTCATGTCGAGAAACGTGCGGCCCAAGTTGGCGCGCATGCCTTTGGGAGGTTCGTTGGTGATTTTGATGCCGT
TTTGTAAGATTGGCACGGGAAACTTGGCACTAAGCGAAGCTTGACATGAGGGCCAAAATCGCACGCATATGTATATACTTCTTCCAACATACCTCGGCAT
ACTCGTCAACCAGAGTCGGAATTGGGGGTGGATGTCCAGTTCCTTGCTCTTTTCCAAGAGTTGCTCGAGCTTCCCTAGCCAACTGACCGCCAAGTGGCAG
TTTTGCAGACACACCCAGTCGCCGGTTTCCCGCGCGGTCTTCATGAGCGCTTCGGCGATCGGACCTTGGCCTTGGCCCAGCGATATGATCTTGAGCCCCG
GACCGTCCTTGCCTTCGTTCTTGGCCAGCTCCAACAAGTAGTCTGTAATATCGGCGCCCGGACTGAGAACAAAGATCAGCGGAATGTCTGGGGCTGAGTC
CGAGTAGCACCCTTTGAGATCAAACGGCGGCGACTCGGTGAAGAAGGCGCCAGCTTCGCGCCCGACAAACTCTCGCGTGCCAAACACGAGCATTTCCTCT
CGGAACACGCGCAGCACCAGCAGCTTTTGGAAATTCGTGAGCGATTCATTCAACTCGCCCGGAATCGGTTCTTGGTGCGGCAACGCCGAGTACAAGATGG
TCTCGCGCCACGTCTGAGTGTATTCGACCAAAGATGCTGGCAACGATTCAAATGCGACAGGGTTCACCTCCAAGAGCGTCTCGACTCCAATCCACACGCG
TTCGGGAAGCCACTTTGGCTTGCGCGTCGCATCCACCGCGTGCGTTCTACTCAAGACAGCGTTAGCTCCCAACCCTCGTCGCATACCTGCTAGATCGATC
AACGACGAGACGACTGTATACATATATATATATATATATACATACCGCTTGGCGCCAATAAGGTAAAAGTTCCACTCGGCCGTGGAAATAGCGTGACGCT
GTCGCAGAATCGACGCGACAATCATAAACGCAAACACGACCTTGTCCTTTTCAAACAGTCCGCGGCACACGTTTACAAACATGCTCATGGTGACGTCGTT
CATCAGGATGTCGAGCCGGGCGAGCAGGTCGTCGGCCTTTTCGCTCAATTCGAGGCGCATCACAAACAGCTTTTGGTAGTACTGCAGCGAGTACTGGTAC
ATCGGATCCACCAGCGCCAAGTTGGCAATCACAAAGTAAATGATGGACCCGCGCACGGCCACGCAGCGGTAGCCTTCGCGCGTGCGGTTGATTTCGTTGG
ACGTAATTTCCGCCTCGGACATGCGGGTTTTGATTGCGCTCGACGTGACTTTGCTGTGGCTTAGCGTGTCGATGAGCTCTTCGTCGTCGAGGATGTTGCC
CTTGGAGTTTTCCAACATGTACAGAATCTTGTCTTCAATCTCCTTGAGCGCCTTCTTGTCGGCGGCAATCGCGACCGTGAGCTCGTCTTTCTTTTGCTCC
AAGTCGGGCCGTTCGTTCCGGACGACGTCCACGAGCAGTTGATCTTCCAGCCCCGTCAACGTCACAGTGAAGTTGATCACGGTCACTTTGATGCACACTT
CGGGCATGTAGTGTGGATTCGCGAGCTTGGTCGTAATGTAAAACCGAAACGCTTCCGAGTACGGAATGTCCGCGTCCCCCAAGTGCAGCAAGTTCTGCCC
AGATCGCTTAAACACTTGCTTGAGTAATACCGGTTCCAAGCTCGGGTCGAGCTCTTCCTCGACATTTTCAAGCAACACGGGCATGCCGTATCGAATCGCG
TTCTCCAACGTCCGCAAAAAGTCCTTTTCTGTCAACTTGATGATTTGCAAGTTGGACGTTTTGTACATGTTTTTGATCCACTTGTTGGCTTGACCTTGGG
GGTCAATCATGAGGGGCCACCGACGCCCCATCGTAGCAAACAGTCCATTCTCGGTCGAAAATGCATCCGCGGGAAGCCCCATGATGTTCCACTCGCGCAC
CACGACCGGGTCGCTCAGAATCCGCTCCAGACTAAAGTTGTTGTCCACGGGCAGGTGCGATTCCTTGCAGAATCGCACCCACATGACTTGCATGTCGGCG
CGGAACTCGGCTGTGAATGGCCCCATGTACGCAATGCACCCCGAACTGAGGATCATGTTGCCCACCAAGTTGATCATGTCCAGACCCAGGTTGTCGGCGC
ATTCCAGCCACCGCCCCTTTTCCTCGCCCAAACTGTCAATCAGCTTCTCCGCGCGGCCGAGCTGCGCCTGCGTCAGCGCCGTCTGCGCCTCGAGCTCGGC
TTTTTTCGTCTGCGCTTCCTGCAGCGTGCGCTTGAGCCCGGCGACTTTGGCCAGCACTTCGTTGAGCCCCGTTTGCTTGATTTCGAGCTTGGCTTGTTCC
GCGGCCAGCGTGGCTTCGGCGCCCTTGAGCTTTTCTTTCTTTGGGCCAATGTTCTTGGCCACCGAGTCGTACGTGTACATGGCACGCACCCACATGCACA
GCGACGTGGCAGCCGACGACACACTGGCGAGGTTTTCCGGCGTGAATTCCTCGTCTTGGACAAACTTGGCCAGTTGGCGGATCGTCTTGGGGGGGATGTT
GTCCTTGTCGAATTCCTTGAGCTTGTCTAGAAACTTCATGTCATTGAGGAGCTTCTTGCCTTCGTTCCACTCTTGTTTCGACCCAAAGAGCAGACAAATG
GCGTTCATAGTCACCCCCACCATCTTTGGCGGGTTCGCAAACGACTTAACGACCGTGATGTCATCCTTCTTGAGCGAATTCAACGCGCCAATGGCGGCAT
AGTACGCCGGCATGGCTTCGTCCAGATCCTTTTGACAGTCGTCCTTGATTACTTTGACTTCGTCGGCGATCAAGTTGGCCGCGTTCACGTCCGCTTCGAT
GAGCACTTGCTGCTTGTCGGCTTCTTCCTGGTCCTTGGTCACTTGGGTCAGCAATTCGGACGTTTCCTGCTGAGACTTGACCAACACGGGCTGCAGCACA
ATCAGTTCGTTCTTGAGGTTACCGACAATCTCTTCGGTTTCCGCGAGCTTCTTGAGCCCGCCACGGTACCGCGCTTCTTTTGCTTTGACCAGTCCGCGCT
GCGTTCGCAACATATCCACGTACAATCGAATCAGCTCCAAGTACGACGTCGGTGTCGTATATGTTTGCCGCTTGAGCTCCTTAAAGTACTTGGCCGTGGC
CGCCTCGACACTTCGATGGATGGTCACCGCCATGTTGCACAACGTCTCGACGTGCTCGTCGATACCCAGCTCCTCCGCCGACGCAGCTAGAAACCGAATC
GCCACGGAATGCAGCGCGTCTTCGGGCCACGCGTTGAACCAGTCGATCGTACAACAGTTGACCAGCGACGGAAACATGCGACAGCGATTGCGGAACCCGG
CGCCGATGGGCGAAAATGCCAGCACAAAGTGCAAGTTTTCCCGAACCAACGTCAAATAATGTGCGATGATGTCTTCCCGAGTGACTTTGCCCATCCCGGC
CGCGATAGGACGCACCATGCTCACGATTTTCTCCATTTCGTCGGCCGCGTACAAGTTGGGGACGTCCCCCGTGTTGAGAATGTTGTTGATGTCCTCGAGG
AACGACTCGACCACGATTTGCGTGTCGCTGAACAAGAACACCACCGGCTTGGCTTCGGCGCCCGCCACCATGAGGATCGTCTTGAGGTCTTCGTGGAACT
CGTCGGCGCCGTACCCGCGCGTGATTTCAATGGAAAAGCACCGGTAGTCGGCCATGAACGCTGCCAGCCGCGTCAGACTCTGCCGACCGCTGCCTCCGAC
GCCGACGCAGAGGGCGTTGCCTCGTGGCTGCCTCAGAATCCGGCAAATGCGACTGATGTGGTGGATCGCGTCGTTGAAAAACACCAAGTGCATTTGACTC
GGAAACGTAATGTTGTACTCCTCCAAGTACTCGAGCAGGAGGCCGTTGAGACGGCTCACGTCTGTCATTTCAGCATACGTGCGATGTTCCCGGGTCGCAA
AGTCGCCATATAAGCACGAGTCAAACACGGCGGGTTCCCAGATCAGCTTCAAATGGGATTCTAACAACGTCGAGCACGCCGCGTTGAACCACGCGCGATC
TGTGGCGTCAATCAACCGATCCCGAAACACCCGCGCTTCTTCATGTAGCCACAGCCGCACGAGTCCGTCCGCCGTGGACGCGTTGGCTTTCTTCACCATG
AGCACGCCTTGAAACACTTTGGACAAGTCCCGCAGGTTGAACGTATAGTGCGACTTGGACGGCGTCGGCAGCAGCTCCGCCTCCACGCGCTGGTACAATT
CCACACTGGCCGTGACGATCGCGGTGGACATGTGACTCAGCGTGGGAATCTCCACGTCGAGGAAGCCACTGAGGATCGACACAAAGATCTGGGTCATCGC
GTCCGCCGACAAGTTGGGGATCCAGCACATGTGGAAGTGCCGGATGAGGCGCGGCGTCACGTCCGACCGGCCGCCCCCCGGTGGCGCACACGCGGCTGCA
AACACGACGTTGATGACGTTCTTGAAGAACATCTTGTCCATGTCGTAGAACCCACCGGAATCGATCACTTGGCGGAGCAGTTCGTTGGGCGGCTGGGCGC
CGTACACTTCGAGCGCCGGCATGTTGAGGTCGTCGATGAACATGAGCATCTTCTTGCCATGGGGGGCCCCAAGCAAGTTTTTGCGCTTCTTTTCCAGCTT
GAGTTCGAGCATTTCGTTCAAATTCGCGGGTTTGGTTTGGGCACTGTAGCCCATCGTGGACGCAACAAACGAGTCGGTCTTGGTCATGTCGTCCAGAAAC
GACTGGATGATCACAGACTTGCCGACCCCGGTCTCGCCACTGTACAGTACGTGGTGGCCATTGGACATGAGCCGCTCCAGCAGAAATCGGAACCTCGTCG
TGTCCTGCGTCGGCACGAGCATCGCAAAGTAGGACGCCTTGGGGTCGTACGTAAACTGGGGCGTGCGGTGCACCCACGACACCCACGTGGCATTGGTGTC
GTCCACAGCGTAGTTGTACACGTTGTCCACGGTGCCGACATATTCGAACAAATGCGCAAGTTGCGTGAGGCAGAACTCATGGAACTTTGGCCGGGACGCG
TCGTCGATGTTGGCGCCGACGCTCCACGACAGGGAGAAGATGAAGTACATGCGTGCAAGCGAGCCCATGTCGGCCCCGTTGCTGGCCGTGCTCGCGACCA
CGGATGGCGCCGACAGGCACGACGCAAGCAGGTTCAGAAACGACTGCATGAGGTTGCCGTTGTTGCTCGGCACTTTTTCGCGGCACTTGGCTCGGACAAA
CTGAATCGCCACCGGTACGTGAATCTCGACCAGTTCCAGTACAATGGTTGCGAATTCGGTCGACAGGATTTTGTCCAACACGTTCACTTTCCACGTGCGC
GCGAGTGAGATGAGCCCGACATGGACTTGCTCCATGTACACCATGCCGCATCGACTGACGGTCGCGGGGGAGGCCACGCGCAGGTCTTGGACTTCGAACA
GCATGTGCAATGTGGACGGAAGTTTGATGCGCTCGCTGTTAGCCAGACACAACGTCTTGTTATCGTCCAGGACAGTGTTCATGTTTTCAATCCAGACGGC
ATCCACGGGCCCGTCAAACACGACCCAATTCCGCGCGTCGCTTTCGCTGGCTTCAGCCACCGCTTGCCGGACGAGTTTGGGGACCAATCCGTCCGTCCAC
TCGGATGTGAGCAGGTTGAATTCCCCGTACAATTGGCCTGCAGAAATGCTCTTGGGGTTCAGAATGAGGCGTGTGACCACCTTGTAAAACCCGTCGCGAT
CGACGACACCTTGCTCGTGCAGTGCCGTCAACGCTTTGGCCAGGATTAGCGCGTTCGTAGACTTGCCGCTGCCAGCCTCGCCGACCAGCATCATGCCGTG
GCGGACCAACTGCGTTTCGTGCACTTGGATGGTCTTGGCCACAAACGAGTTGACTTGTTGCAGATTGAGCACCGCCAGCTGCGTTTCAATCGCCTTTTGC
AGCACCCCGTAGTCGACAAACGGCACCACCACACCTGGAAACAAGTCGCTGATGATGCCACGAAACAGCGGCAAGTCCGCTTCGAGGAACTTGGGGACGT
TTGAGTCCCGCATCGCACGAATGAGCAGCAGGTCCTCGTGCGTCTCGGGCCACTTTCGCTTGAGCTGCCCCGCCGCCACGAGCACCGACTTGACGGCGCG
CATGCCAAAATCGTAATGGTCCTGCTTGGACAGCTGCTCCGACGACAGCGAGTACAGCTGTGTCATTTTGTGCGATAGCGGTAGTGCGTTGGCAAACCCT
TCGGAAAACAAGACGATTTCCGCAATGAGGCGGTAGTCGGGTACCATCATGGCAACGGGTCGGAACAGCGCCTTGAGGTTATCGGGTAGTTCTGTCCGCC
CAGCGTACCCAGGGTTCATCGTGATGAACACGCCAAAGCCAGTGTTGAGTCGAATGAGCTTTCCTTCAAAGTCAAACTGGTCGGCGTTGCAAATGATGGC
CTGTTGAATGCACAAAACTTGCTGGGCAATCACACTGAGTACTTCAATATCGATGCGGTTGAACTCGTCAAAGCAGGCCCATGCCCCGGCTTGGGCCAAT
CCCGAAAAGAACCGCCCCATGATCTTGTAGTCTAACCCGTCCGAGCAATTGAACACGACGCACTGCACTGCCAACGCCTTGGCCAGATCTTTGGTGGTTT
CCGTCTTGCCAGTGCCGGCGGGACCAGCGGGGGCGCCCCCCAGTCTCAAATGCAACGCCCCCGTCAGTGTCATGTAGCAGATATCCGTGAGCGGCGTGAT
GACCAGCCGCGGCGTGTTGCCCAAGTACTCGTACGCGTACACAAACCGCGTGTTGGTCTGTCGCGCGACGCAGTTGTTGATCTCTTCTTCCCAGTAGTAC
CGCAATTGGCGCGTCCATTCAAAGTCCGTGAGGCACGACACCTTGTTGGCGCACAGCGAACGTACCACGTCTCGCGCGTGCACGTCGATGGTGATGAGGG
CCCCCATGAGGCTTCGCTGCAATTTGGTCAAGTCGCTTCGCACCAACACGACCATGCCGTCGATCTGCTTGAGACTGAACGCTAGGAACTCGTCCAATGC
CTGTGCGTTTTCATGTCGCTCCACTTGGACGATCGCGAGGCCGACGTTGCGCGTCCAAAACACTTGGTCGATCATGATGATTACCTGCGACGGAAAGGCA
AACAGCCACTCCTTGCGGTCGATCGCGTGTTCCACGGGGTACGCCTTGAACGACGCGTACGACTCGGTGTACAAACTATCGCGCATAGCTTTTTCGACCT
CGAGCAGCCACATCTCCACGGGCCCTTGGGCCACGACGACATTTGGAAACGTCACGCGCTCGCCTTCAGCACTCACCATGGCCGTGATGCGGTTGCTTGG
GGTCGATTGCCCCGGCAACGTCTCAAAGTGGACCGACTTGATTGCGTCAAAACACTTGCTCAAGTGGGGCTGTACGGCGCGGGGGTCACGGGTCTGGCTC
AGGATTTCAAGCAATTCGTCATTGGACAAAAAGTAAAACCGGGGAAACGCCATGCGCTTGGTTTCCAAGTAGTCTTCGAGCGACTTTTGGATCTCCTCGA
GCAGCTGGTTGGACACTTTGAACTGGTCCAGCATTTCGGAGCCGTTCTCGACCGCTTTGAGCACGGACGGGTCGTCGTTGGTACGAACCATGGTCGTGCG
CCAGTTTTTGTCCACCAATTGAAACTTTTGAGCTTCAATCGGCAATTGCTTTTGAATGTCCTCGGCGCAAAAGATCGTCTCCAGGTACATCCAGTTGCGC
TGACAGGTCACCCACTCATCCAGCGTCTCGGACAGCAGCGCGAGCTTCTTGTTCCACCGGTCGACTTCGTCTTTGACGCCCAGAATGAACCGCGACCCCA
TCATCGTCTGCAGCGTCACTTGGTTGTCTTCGAGCAGCATCAAAATGTCTTCCAATCCCCCCAAGATGAACATTTCCTTGGAATCGCGATGCGGGATGCA
CGTAAACTTGGTTTGTTCCCATCCCAGCTTGATCTTGTTCAGCGACGCTTCGATCTGCGCCTCACCAGAGGACGTGGCCGAGATTTCACTCACCAAGTCC
TTGAACTCGAAAATGTCGTACGCGATCAAGTTGTCGAGTGTAAACGCAATCCCGGGGTACCACGGTTGGTTGAGCGCTTTGAAGATTTTTTCCCAGTGCC
GGTCCTTCATGCTCGGCGACCCGAGCTCGAGAATCGTGGGGATTTTGAGTTTGAACTCGGCCGCCTTGTCTTTGAGTAACGCCGTCACGTCGTTGCTGAG
CTTCTTGTGCATCGCATACGCGTCTTTAAACGCTACGGCCACATCCTTGGCAAGTTCTTCGACTTGAATGTCCGCGAATGGATTGTGTAGCACGTTGCGC
TGCTGGTCGTTCCACTTGTCCACGGCTGTCCACAGCGCTTCCACCGTGTTGTAGTAATCCATCGTTGTTGTCAAGTTGACATAGTTGTACGGGTCGATAT
TGAACAGCGTTTGGTATTCCGAGTACTGCTTGGACAGCTCCTCGAGTTGCCCCAGACGTTGCTTGACCACGTCCAGCTCGCCCAGCACGATACCCGTCTC
GTCAAAGTTGGTCGCGTCGATAAACGCACCCGTTTGCAGTTGCTCGTTCAGTTGCACCGTTTGTTCGTCCAATCGAGCAATGTTCGAGTCGAGTTGCTGC
GTCATTTCACTCAACTTGCCGTGGATGTACACGTCGACGGCGTCCGTTTCTTCCTTGTAGCTTTCCTGGACGCTTCGCAAATCATCTAGCTGGACCATGT
CTTCGCTGCTAATGCGCACGCCGTAGTTGCCCAAGAGACGGTACATTTCGTCGACGACGTTGGTGTTTTTCACAAGGGCCTTTTGCTTTTGCTTCAACCC
TTGCACGCGCTCGACGTGCGCCGCAAACTCCTTCAAGTGCTGCGGCCGTTGGCTCAGCATTTGAATGCGCTGCTTGTACTCGCCCAACTGCAGTTTGCAC
TTGGCGCGGGCTTGGTCTTTCACAAGGCCTTTCATCGCGTCCAGCTTTGCCGCGGTCATCGGAATCAGGTTTTGCTTTAACTTGCGGCTCTCGACGTGCA
AAATGCCAATCGTTTGGCCGGCGCGCATCTTTTCTAGCTCTTTTTCCCACGTCGCGATCTGCAGCATGTCCGCCTTGAGCGACGTCACCGTGTGCGTGCG
CTGCGAGTAGTCGCTTTCAAAATCCCACTGCTTGTCGTACTCAAAGATGGGCCGAACGCTGTCAAATATCTTGACGTAGTCGGTGGCTTCCGCATAGTCG
TTTTGAATCTTGGCAACCAAGTCGGCGCGAATCGACTGAAAGTCGACGCTGTGGGTGATCGTCGGCCCAATGTGGGGCCCGTCTGTAATGGCGTTGGCCA
TGTACTGGGCAAACGGGCGCAAGTAAATGATGCGCGACACCGAGTTCACGGCGCCGACAATGTCGTCGGTCATACTCACGACGATCGCCTGGATCTGCTC
ACACGTGGGCGAAAACACCGTGTCCGTGTCTCCAAAGTGGATCGTTGTCTCAAACAACCCCGTCTTGCGCGGCGTCTTGGACAGCTCGGCGAGGAATTCG
CGGCAACTCGCCACGGCCAGCAGCACGAGGTTCTCGGTCGTGATGTAGTCGATGAGCCGAATGAAGTCGCACAACATGGACGCTTCTTCCGCCGCGCGCT
TGAGCAGCTTACGGCGCTGAATCTGTTCGTGCTTTGCTGCGACGATGGACTTGGTCTTGTCGGCATGCACGGACACGGACAAGTCGTTCAGGTCGTCGTT
CTGGTGCGCTTGGCGGGCGAGGTTGTTGACGTCGGCGCATACTTTTTGCGCAATCGCTTGCAGTTTCTCGACACACGACTCAAACTGCTTGGACGCGTCC
GTGCGCTTTGTCGCTTGGTACTCGACGAACGCGCTGGCTTCGTACGTCTTTTGCGCGCGAAAGTCTAGCAGCAGCACGCTCTGTAGATCCATCATGACCT
TTTTCACTTGCAACAGCGGCGTCGAGAAGCTGTCCTTGCCCAAGTACAACGTGTTGCACAGCTGCTTGCGCTGGCGGCAAAACAACTTGTACCGTACGCG
CGTGCTCCATGCCATGAACGCTTTGTTCACGAGGTAGTACTTGTAGAAGCGAAAGTTCGTGAGCACGTTGAACAGCGTTGACTGGCGCATCCACTCTGCC
AGCGCGATGAACTCGGACGGCGACCCCGGTTGGATGTGCACGAGACCACTGGCCGACATGGTGAAGTGCTCGGCCTGCGCGTCGCCAGGCAGCACGACCG
TGAGATCGTACGGCCGGAACAGCAACGCCGATTCCGCTCGGTTCAAGTGCACAAACTTGATTTGGCTGTTAGAACCGTTGCGTGCAAAGAACGAGATCGC
GTCCTCGCCCGTGTGCAG