Description :
From Genome Similarity Track
Location :
Scaffold_200:123630- 126893
Sequence
3263 bases(100 bases per row)
CCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCCACCGGGCCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTACGGGAACATGTGGATCA
TTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGCTACGTGTCAGACGCAGATGAGCTTGCAGAAGTGCTGCGGGCTGTGGATCG
CGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATTGCCAAAAGCCTCCGACGCCTACGGCTCCAGCTCGACGTGTCCACCAAGTCACG
GCGCCCGACTCAGGAACTGAATTAGGATTCGACGGTTCGGACTCCGACCCAGAGGATTACCGTCGAGTCTGTCTCACTGCATCTAACGATCGAACGGCGA
AGACCGGAGACAACTCGCGATCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATATCATAGACGGGACAGCACAAGTCAGGTGTTC
GCAGTGCGGATCCCGGAAGCACACTGAATATGGATGCTGGAAACATCTGGTCCATGATAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTAC
GTGTGTCGCGGGTGTGGTGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAG
GGATGTTACCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGATATTGCATTTATGCATTT
GTGAACAAGACATCGCTAGATCCAGGTAGCAGGTCCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTCGC
GCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAACGCCATCATGGTCGATG
GTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCATCTAAGGTCTATCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTA
ACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTAC
TCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGATCCAAGATTGTGTTGGGATT
GGTGAAGGCGTGTACCGTACAAATGGGAGAACGCGGATCAGGATCACGCTGGCAGGATGTTTGGTATACTGGTTCGATATTTGGGTTGAAGATCTCGCTG
GTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCTGGAGTGAGGTTGGATCTGGCGGATGGGACACTGTGTTTCCCGGACGAGATGCTGATCCA
GCTCAGTGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCATAAGGGCAGATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAGCTGCCAGAT
CGGTTAAAGTGGGTGGAACATGAGAAACGGTGGGTCACCCGGGGCGAGAAGTGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGG
TCACTAACGTCAGCGACAAGAGACTACTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTC
AGTGGAATCCCGTCGCTACAGAGAATGACAGAATTTGGCGTACGAGGCAACTACCGAGATTGAATCTCGCGGAGAAGGGGAGCCCCCGGCGGAGCCAACT
GGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGCTCCTACAGAGGGATCGTCGGATTGAGATCCAAGCGGTTGAGGTTGGATCCAAGACCG
GGGATGATCCCCAGAGCCGGTCTCTAGATAACCCAGGGTCGGTGGACGGAGGATCGCAGAGAGCGGAAGCCGGGTCGCCAGATCCTGCTAACCCACAAGT
GGATCCTAGCTTTTCATGGGACAAAGTGCCTGGATCCTTGTCGAGAGTGGCGACGCTAGTCAAACAAGAACCGTCGCATTTAAACTCGCTAGATGATCAA
GTCGATCAAACAAGTGACTTCCCCGGTACCAGGGTACTTGATCCTACGAAGACAGAAGGACGACGGTTGAAAGAGGGTCGCGGTGCTCGGATCCAATGTT
GGATCCGACGAAGACTGAAGATGAACAAGTCTGTTACCATGAAGTCGGGGATCTACACGCCGAGGATCTCGGTGAAGGCATGGCGGTGATCCCGAAGGTA
CCACTGACCACAGAGGAGGTCACGATTGACGACATCCAAGTGGATCCAGGGGCGAACGAACCCGCGGAAGTGAATCGGTTACGTCAGAAGATCTGGGAAA
GCTGACATCTGCTGATTGGTAAAGGTAATGCATTATCGCCCGCTGCCCGCGGAGTCAAATGTAACATCGATGTCGACGACGCAAAACCGATCGCTCAAAG
GGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTCCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCA
TCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGCCTGCCTCGATTGATGGTGTATCCGA
TGCCTCTAATCAATGAGCTGTTGGAAGATTTAAATAAAGTACTCTGGTACTGTTCTCTTGACATGGCCAGTGGTTTCTGGGTGGTGACTATGACGGATCG
AGCTCGCGCGATATCCACATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAGCGCCTG
ATCGATAACGCCCTCTACGGATTTACCCGCATACCGGAACCCGAAAGGGGTGGATCCGGGGAAGGTCATACGGAAGTGGATCCATTCGAAGCAGAAGAGC
CAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGAC
ATCCCTACTGGAGGCGTGTACTAAGTGGAATCTTTCTATCAGTGTGGTAAAGAGCTATTGGGG