Description :
From Genome Similarity Track
Location :
Scaffold_11:1236067- 1239238
Sequence
3171 bases(100 bases per row)
GCCACCTCTGCTGTCTATGCGATGTGTGCTTGCTTGCGTTGAGGTTAACATTGCTGTTCTAAAAGGAGGTTAAGCTTTGTGTTTGACGCAGCACTCATAT
GTGTATTTCGTGTACTCTGTAACGAGGTTAACTTTGCTGTTCCAAATGGAGGTTAAGCTTAGTGTTCAATACGGTGCTACCAATGCATAAGTTTAGGTAC
TGCTTCTTAAGCATGCAATACACCCAGTATTAGCTCTTACTGCTTACTCTGTGTTACCTTCTGCGTCGTTGAGTGAGTTATCCTCCACAGCCTCGTCCTC
GAAGAAGCGCTTGCGAACAAGAAGGCGGCGCTCCTTTTCGAAGGCAGCAACAACAGACTTGTGAATGTGCTCCCTCGGCTCCCACGTTGGCTGCCAGTCT
ACGAGGTAGTACGTCTGCCGTTTCTCGCGCTTCCACGTCATCACCTTGCGTACGTGGTGCTGCTTTTCGCCGCCTACATGATCGTCGTCATCTTCAGTTG
GAGGAGGCTCGACTAGCCATTCGCGAACATCATCAAGGCCAGCCCGCCGCTTCTTCCGATCCTTCATGGCTTCGTAGACGACTTGGACGGCTTCGGGAAG
AAGGCTTGCGGATGCGACGATCGTGTTCAAGGTGAGTCGGAGGTTGCGAATCGCCTCACCATCCAGGCGAAGCTTGTACGCCTTGCCTGTTGTGATACAC
AGGGTCTTGAACTCTTTCCAGGAGCTAACAGGGTGCTTGGTCGGCTTGATCGTTGGCATGATGAGCAGTCTGACTGTAAGGTGGGTTGTAAATTGCAGAA
TGGTTTCAAGGTTGAGTAAATCGAAAGGAAACGACTGGACCAGACAAGTTGCGTGCTATTACTGGATGCAATCTAACGCTATGACTTTATTCGTATGCAA
AGGTACAGGGTCGGAGATGCGTCCCGCAGCGTGAAGTTGGTGATAGCTACGGATATGATCGTTGAGAATACCGCTCTTGTAAAGCCTGCGCATGGACTTC
AAGACATTTTGGGCTCCACGAGCGGTGATCCTGCGATCTTAAAGAAAATCTACCAGCTTTTCCTCAGCTTGTGTCCCTAAGGCCAGTACTTCATCGCGAT
ACGTTGGTGATTTTTCGCTCAGCTTGAAACCTTCGGGGAGAAACAGCTTCATGAACGCCACAATCATCTTGAAGGTAGACCTTGTGTGCTTTGTAGCCGC
GTCTGTCGAGCGCCACATTCGAGGTTCTTGCGCGTACCAGGAGTACCATGCGTCTTTTAAGCTCGTAGCAGCAGAGGTACGTCTTCTCTTTACTGTCTGC
GTGTTGCTGACCGCTCCCTCACTTGTGTTGTCTCCTGATTCTGCTGTTTCTGCTCGTTCGCGCTTGTTGTAGATCTTAGACTCCATGGTAGACAGTCGGG
CGTCTAGCTTTTGGTTGATTTGGATTAACTGCTCAATCAAAGCCGTTTGCTGACGAAATACTGGGTGCTTCATTATATCTTCTGAAGGAATTGGAGGGGT
TAACATGCTGGGTTTCCCATCCGGGCTTGTGCTGCTGGACAGGTGAGGCGACCATGCAAGAAGCTCATTCACGGATACCCCTTTTGCGACTGCACATGAC
TCGATACGCTGTACCGCTAAGGCGTCCGACTTCACGCCTGTCAAGGATGGATAGTGGCGCAACACGTATGCCATGAGGGTATCAGCGATGCGTGCGTTTA
TGTTGAAGGCCTTCACATCTAGTCCAGTCGAAGCGCCAAACAGCACAGAGGCGACAGCGCGAATCTTCGCTTGCGTCTCAGAGTCGAAGAAGTCCAAGGT
TAGTAGTGGTACCGGTTTCGCGGGGTCGTGGTCACTCAGTACTTGAGCAACTTTGTGATCTTCGGCTGGAGTGTTGAAGACGTACGCGAATGCCTTGTTG
GTCGACGTCATATTCCACGCGCCTCTATCGAAGATCCATTGAACGCACATACCTGACCCGTTCGCGTGCTGCGCTCCTCCACGTCGAAATGAATGCGAAG
TCAGGCTATCACTCACACCTGCCTTACCCATGACTCGCTCGAGAACGCGATTAACGTAGCTGTGGATACCGGGCGAGGCGTCGACCGTTTTCGGCTGTCC
ACCAGACTTTGGTGCGTCTTGAGGATGGTCGGTAAAGTCAATCAGAGGTGCAGCTGGCGTCTGAGATGGTACGGAAGGCCCCTGCTGTTCTGGAAGCTGG
TTGAGAAGTGCCGCTGTTGGCGATGAGTGCGTGATTAGCGCAAGGGCAACGGCAAGCAACGGACACGTGGTAAAGTCGGAGTCTGGGAAGAGTGATAAGT
CTTGCTCCTCGGAAGTCTTGACCCGGATGAGCCGAACGAAAAAGATATCGCCGGATCCAATCGTCAGATTCGTTTTGCGGAGAAGCGTAAGGTCCGACGC
GCGCCCGAACAGGTACCAGAGTAAGCATAAGAGCGCCGCATCTTGGTAGTCGCTGGCGCAAGTTGCAGTTGAATACAAGTATTCGGTCATCTGCTTAAGA
GCTTTCTTCGTGCATGCTGGGGCCTTGTTAACAAACGTTCCTGTCTCGCGTTTCATGCAGTAGCGCTCCAACACTTGGCCTTTCTTGAGCAGATTCTTTT
CAACTGCGACGCGATGCTGGGGAAACTGGTCGAGCAACCAGTTCTTTGCCTGTCGGTAGTACTGCATCACCGAGTGTCGAGCTAGAAGCTGTCCCTTGCG
GCCTTCCTTGAAGGCAAGATACATGCCAAATTTGTCTACCACACCTTCTAGAACCAATGCGGCCGTATCGCGGCTCATAGACGCCTCTAAGTATTCCCAC
GTCACATCTTCGTCTTTTAAAAACGCTAGAAACGAGCGTGCTGCGCTTTCCCGAGCGCGCTTCGTGTTAACGGGCGCAAGATCGTTGAGGCTCATACTGA
GTCGGAGATGTCGGAGCTTTCACGTTATTCGAAAAAATATGTGAATGACTTGCAGTTTGTAAAAGGATATCAATAACTGGACCGCTCCCTCCGACCCGAT
ATGTAGGAGCCAGCTCCAACGAGATTCGACCTAACCCTTACCATTTGGATTGGCCAAATCATTTTGTCAAGACCTCCCGATTGGCTGTCTAATAAATAAA
AATGGATGATTGGAGATTAATGCCAATACTATAATTAAGTTGGGTCGGAGAATTGATGATATTCATCCATA