Description :
From Genome Similarity Track
Location :
scaffold_5:123602- 126993
Transcript NameFunction/comments
g8122.t1hypothetical protein

Sequence
3391 bases(100 bases per row)
ATGAAGCGACGGAGCAGTTCGGTGCGAGACGATGGCGGCGCGGAGCAAGAGCGGGGCGCGCACCTTCAACTCGCACAGCGCCACCGCAAGATCGTCGCCG
GGAGCTTCAAGGGCCACTCCGCGCTGGAGCCCGAGTTCGCCACGCCCGGCGTGGTCGGCAAGTTCGCGCTGCGCTTTACGACCACCGGACCGCTGGCGAA
GCACGCACGAATCACCTGCCAATTGCCGGACCACGGCTGGACGCTACCCACTGCGTCGCCGCCGACTGTCGTGCTGCAACTGCCGTCCCCGAATGAGCAG
GCGACTACCGCCGCGCTGCCGCTGGTGAAGATGAACTGGAGTGCTGCGACTAGAACGATGGAGTTTACGCTGCTGAACGAGAGCGTGATCCCCGCGGACA
CGCCCTTGGTTCTGGTGGTGTCGGGCGTGGGGACCCCGGAGAAGGCGACGCCGCAGAGCGAAGCTGTCGTCACGACCTTCGAGAAACTCGTGGCGAGAAG
CACCGTTCCGGCTTCCACACGCGGTGGACAGATCGTTGATGGGCCTGCTGCCTTTGCAATTCCGAAAATCGTGCCGGGGTCGATTGGTGGGGCGAAGCGC
TGGAGCCCGTCCAATTGCTGTCCGGGGGTAGTCTCCGACGTGACGCTGGCGTTTACTGTCAATGGCAAGGTTCCTGCGGGCGGGAAGCTGCTCGTGGAGC
TGCCACCTGACGGCTGGGATATGGACGGCCAGCCCAAGGTGCTGCTTCGTACGCCAGTGTATCACAACAAGGTCCTCACCGCTTCCTGGGATTGCAATCA
GCACACCCTAGAGATTTACCTAGGCAATGATGGGGCGTCTATTGCTACCAAGACAAATGTGATCCTGACGGTCGCACAGGTGAAGAATCCAAAGAAAGAG
ACTATGATTTTGTCCGTGTCAAGTGCATCGAGTGAGACGCGAGCTGCTGCTCGACTTACCACGCTGTCAGCGAGTGGTGGCGTGATTGATGGCCCCAACA
AAGTGGACGTGGCGCGAATTAGTGAGCTCCGAGAACGGGACTTTGAGGTCCTCACAAAAGTGCTTGACGCCGATGCAGCAGAAAACACTGAGGATGGCAT
TTCCATTGCCAGAGTTCCAGCTGTCTTGCGCCGAGCAGGTTTGACGCTCTCGGACGAGCTGTTTCAGTCGCTTGTGGCTCCTTGTTTTCCAGTGCGAGAG
GACCCTCCCAGAGGTGAATCGGAAAACAACGAAACGTCGCTGGTTAATACACCACTCGCTGCTACAGTAACACCGACCACACCGGCAGACGATTATCTCT
CCAGAGAAGAGTTACTCAATGTGTTCGCTCTGGTCTACGCCCCGGCGTACAAATACGGCCAGGAGCTCCGTCTAGCATGTGGTCGAGGACATGTGAATCT
CGTACGAGAGTGGATAAGTCGCGGCTGCAACCCAAATGCTGGGGACGCTTCAGGTTGGTCATCGTTGCACTACGCCGCCGACTTCGGCCAACTCGAGGTG
ATCAATCTGCTCGTCGAGATGTCTACGCCACCTCCAGAGAACGAGTCCATTGGCGAAAACAAATTTTGCACGCTGGAGATCAATGCCCGCGATGGCCACG
ACTGGACCCCACTCATGTGTGCGGCAGCGAATGGCCACGTCGACGTCGTCCAGAGGCTGCTGGCGCTTGGCGCGAGCGTTACACAGACCAGTGCTGAGCA
CCGCTCGGCTCTGCACTGGGCAGCAAGTCGTGGATTGGCCGCAGTAGTCTCCGCTCTGCTTGCCGCTGGCGCAGACGTGCACCAAGCGGATCGATGCGGC
TGGACGCCCCTGCACTGCGCGACACTGCACGGCAACACGAGCTGTGCGGCGCTTCTCGTCGAGAAAGGCGCCGATTCGTCGGCTCGAGATAAACTCGAGT
ACACACCCACTTTCTTCGGCGATGCCACCTTCCTCCTTGCGCCGGCAGGCCCGTAGCAGCAATAACTGTACCAAATCCACGCGACCTTTGTCTCGTCCGA
GTCCAAGCAACTGCAGCTTCAAGTCAATGCACTCGAGTTCGCCAGTGCAATCTAACTGTGACGCCCTCCACCTCCTGCAGCACCTGGTGGAGCGTAGGGG
ACTCCTTGCATTTCTTGCATTTCTTGCATCCGAGGATATAGACAACTTTCGTACTTACTCGAAGACCGCCGTTGCGCAAGCACCAACTTGATCCACTAAA
GCCCAGGAGCTCCTCACGCTCATTTTCCCAGTCTCGGAGCCATGGCCACATCTGCAGGAGCCAAAGTGCTGGCTGAGGTGTACCGCCTGCACCACATCCC
GCTGCCGCCTATTACGCTGCAGGCGCTACTCAAGCGAGGGCCCCGTGCCAGCCCCGCCATCACTGCGTCGCTGCAGAACGATCCGCAGGCGCTGTCCAAG
TGGCGCGAGGTGAACGCGCCCGCCATCGTCACATCCGCGCAGCTGCTGCATCGCGAGGCACCCATCCGCATCGCGCGCCGCATCGTGGACCTCGAGAACC
TGCCGGACGAGCTGCCAGGCGCGCAGCCCATCGTGTCTCTGCGCGAGCAGCTGCTCAACAGCTTCGAGCAGCTCACGAGCTGCCCGCTGCCGGCTAACCT
CGCGGGCGAGAGGGACTTCGTGGAGCTGCACCTCAAGATCCGCAAGGAGCACGCCACTATGCACGGCAACATCGCCGAGGCCGTACAGGCGCTCGAGTAC
GAGCCGCAGGGACTCAGCGAGTCGCTCGACAACTTTTACAACTCACGCATTGGCATCCGCATGCTCGTGGACCAGCACGTTGCCGCGCAGAGCCCGACGC
CGGGCTTCACGGGCATTGTCAGCGACGAGTGTTCGCCCGTGCAGATCGCGCAGGACATTGTGCACAAGGTGCGGCCGCTGTGGCAGGAGAGCCTCCACGG
TGACCAACTGCCTGCAATCGTTGTGAATGGGGAGGTGGATGCTACCTACCGCTATATCCCGCAGCACATTGAGATCATCTTGACCGAGGTGTTCAAGAAC
GCGGTGATTAACAGTGTCGCTGCGACCAAGAGGACGGGAACCACCACCCCGCCGCCTGTCACGGTGCTGATTTCGGGTGGGCCGCACGGCGTGTGCGTCA
AGGTGTCGGACCTTGGCGGCGGCATGACTCGCAAGGAAGCCAATGCGTTGTCGAACTACTACCACACTGCGACGTCGCCGCCCTCGAGCGGATACGACCC
CGTTGCGGATGTGTTGGAGAGGCGTGCTAGCGGACTGGACTTCTCAGACTCGTTCGGTCTGCGCATTGCTCAGCTCTACGCCAAATACTTTGGCGGCGAG
TTGGCGATCATGCCTATGGAAGGTCACGGTGTGGACACGTATATTTACATGAACTGCCTCACCGGCGCCTCTGAGCTCAAGTAAGAAAAGT