Description :
From Genome Similarity Track
Location :
Scaffold_282:1236- 5041
Sequence
3805 bases(100 bases per row)
GTGGCTTGAAAGGCTAGATTCTGCCATTCCATGTATCGACGAGATCCGATCGACACATATCCTGGGATCCGGGGTATCCGATCTCCGGCCAGCCACATCC
CGATCCGTTCATTTCGATGCAAGACAAGATCTTTGTCACTGATGTTGGTAATCTGGAGATATCTGATCCTGCCGGGTCCTCGGACCACGGTTGGCACCCA
GCGATCTCCTCGGGTGACCCATAGCTTTTCTCGATCCGTCACCTTCATTCGCAGCGGAAGCTCGATCGAATCCCCGATCGCGATCTGCATTCCCTGATCC
ACACACACGTGTCGGCCATTGTCGTTATACAGTTGACGCCGTCCGCTAAGCTGGATCTTGACTTCGTCGGGGAGACAGATGGAGCCGTCCGCAAGATCGA
GGCGGATCCCCGCTGGAACCATAAAGTCCATACCCAGGATCGCCTCTTGTCCTGATAGATCGCCAACCCAGATATCGAAGAAATACACCAGCGATCCCGC
CAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTCGCCAATCCCCACACATTCCTGGCTCTGACTCGTGTCGACATAGCACCCCACC
TTACGAGCAAAAGCGGTGTCCACGATGGACACCTCGGCGCCGGTGTCTAAGAGTAAGATCGACTTCTCATTGTTGATCTTGCCAGTGATCTTGGCCTGAC
GGAACCACTTACCTGGCGAATGATGTTTCCAGTACCCTCTGGACTCTCCAGGGAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTTCACTGACGCG
AGGCCGACTTCGATCGCGATCATGCTCCGGGATCTCGGTCGTCACTTCTCCATCAGCTGGCGTAAACCATTCTTCCGGTCTGCGTTGCTTCCAATAGCCC
CGCGTTTCTCCAGACTGGAGATCCAAAGGCACTTCGGCGTCAGAACGGCTGAAGTCGTCCGATCGATGTAGACTTAAGACCTTGGCGGTAGATTTCGCAT
GCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACTCGATCTACCGTGTTCTTGTTCACGAATGCATAGATGCAGTACCTAGAACGCTCGGC
TCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCGATCGCGGGCAACATGCCAGCGTGCTTCACCGGGTTGAACCATTGACGGA
TCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTGTAGTTCACCACATCCACGGCACACAAACAGGCAGCGATCCGCCGGATGACCTCTCTT
GCCGCACTTCTCGCACGTCAAACGTCTCCAACAATCGAGATCGGTGTGTTTCCGCGATCCACAATGTGAGCAGCGGTTTGATCGCTCCGATCCGTCAGGT
GAAGATCGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGATCTGCGCCTGGTTGATTCGATCCGGCTTCGTCGCGTCGCCCCCAGCGTTACGGGACT
TGTCCTCGGTCGACGCTAGGTAAACGCGACGTAGATCACCCTCCGAGTCCGATCCGTCTGATCCCGTGTCCGATCCAGACTCCTGGCTCGCGATCTGCGC
TGCACGCACTGCCCGCTTGGTTGCAGCAGCTGGTGCTGAGGTCGGAACCTTCTGACGATACTTCGATCCAAAGGCGGATCGCTTCTGTCTGCTCATCGCG
CGCTCTCGAGCGCGTAGGACTTCCTCCAGATCTTCTGCGTCCGCAAGCCGGAGTACGATCGGCCAGTTCCGGATCGCCCAGCGTCTCGATAAAGTGTTCG
ACATGTTCTCGGCGGGCCTTGGAATCTCCGTCCTTGATCTTCAATCTCGCACGCAGAGCCGCCACATTCAGTCGATAGAGGTACTCCAACGGCGATTCAT
CTGATCTCTTGCGAGAATGGTAATACTGCCAAGCGACCGATACTCCCAGGCCACAATACTGGATCTGGAAACTCCGGAGTAGATCGCTCCACTTGATCCG
CGTCGATCGGCCCAGCTGGTGGTACCAGTTCTTCGCCGGGCCCGTCAGTAGATCAGCAAAGGTCAGGCACTTCTCTTCGTCCGTAGTCTGATTTCGCAGG
AACGCCGACTTTACCTTGCTGATCCACGATCGGCCGCGGTCTTCGTCCTGATCCTTGCCATTGAACTCCTTAAGATCGGACATCGCCGAAATCCGCCCAC
GCTGGATCAATGAGGACCCAGTGGATCCTGAGGCAGCGGTGGCCACCGCAGCAGGGGCTGAACTCGGTAGATCAATGTCGTCCGGATTGTATTCCTACTG
AGAGAGATCTTGATCCAGCGATCCGGCTGATTCCATCTCCACGTCCCGCGAAGACTCCAGTTTGCCAGTCGACTCATCTGATCCGGTAGTACTGGTGGTC
CGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCTGACGTTGACTCCGTCATCGTGCGTCCAACATCGCAGATCCTGAAGGGC
CGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACGTATTCCGCTGCGGAGACATAAGGAGACGACGATCGGTACCCAGTGGACTCCATCCGCGG
CGACGACGCGGGAGCTGGCGACACTAGATCTGGCACCTTCGGGTCCGGACTGTCCGCGATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGG
ATCGCTGTCTGGATCACATCGAGATCCTGATCGAAAAGATCATTCGCTTCAAAGGCGCCAGCCACGAAGCCGGCTTCCTTCAACAGTCCGAGCAGGTTCT
TCACCGCCATCAGCTTGTTGTCCGCCACTCGGGGGGCCGAGATCGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTG
ACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCCAGGTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATTTTCGTCGTCCAGGCCT
GGCGCTCTCAGCTTCTTCCTCACAATCTGGTCCTTGTCCGCGATCGCGTCCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGT
CTGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCGCACCAAGATCCACCGGGGTCCCCGAAGGGACCTGTGGAGGATGTTGAGGTTTGTCTTC
TAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAAGTCCTCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTTGAT
CCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACGGACTCACGGTGAAATCCCTGGTTCGAATCCGGGCACGCGCACC
ATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGGTCCCCCAACGATC
CGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATATGCTCTCTCGGGACTCCGAAGATGCAGAACTTGGTGAAGATCGAGTGT
CTTGGCGTGACGCGGGGATAGTTTGTGGGGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGG
CCTGGAGTTGATCCAAGGCCTGTAGTCGCTTTTCCGGGTGTGTTCCTTCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGA
GGAGA