Description :
From Genome Similarity Track
Location :
Scaffold_2160:1236- 3211
Sequence
1975 bases(100 bases per row)
CTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTA
AGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGAGGATACTGGAAGTACCATGCCCCAGG
AAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCC
TTTGATCGTAAGGTTGGGTGCCAAGTGGATGGAAGTCGGATCCAAGATTGCGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCA
AGATCACGCTTACAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTGCCAGC
CGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGATATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCAAATATGAGG
ATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGATAGGTTAAAGTGTCTGGAACATGAGAAAATGTGGGTCACCC
GGGGCGCGAAATGGGTGCCTACCGTAATCTATGTACAAGGTTGTGATGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCG
CCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGAAATCTTGCTCTCTC
GGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGG
ATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCTTTGCGGGTGTGTTCCGTTGCCTTT
GTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGATCTTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTG
TCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCGCTACCAACACTAGATTCGCAATTCCTAACC
TTCACGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCGGGAAGGCACTTGTGTGTTACTGTGCAAATTGAGGACTGTATTGATGCTTAAGCCT
ATACCTGCCTGGATTTCTACCTTCTATGTCTTTCCCTCGTTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTG
TATTATCTTCAGATCCACCGGATCCATGGCGTAATCATTATGGTCACCCTATTATGGGTACACTCGTTCGGATCCAGGTCGCTTGGATCCACTTCACTGT
AAGTGTACACTCGTCGTGGATCTGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATCTCCATTGTCTCACGAAAGCTCGAGACCCACTGC
ATCCATCATCCCTATACCCTGGATCCAGGTCCCTCAAGGCGGAATCCTCCCTCCTTGGATCCGAATTCGGAAGTATGGGATCCGGGGTACCTCGCGGTGG
ATCTTGACTCCTCATTAGCCGTGGATACTAGATCCACCTTCAGAGGGCAGCTACCATCATCCCTTCATAGGAACCACACCCGAGCGACTCTTATATAGTA
TATCCCATATCCATCTTAGTGAATCCAGGTAAGGGAGGGACCCGAGAAAAGTCTTGAGCGAATCTTGACGTTCTC