Description :
From Genome Similarity Track
Location :
Scaffold_2825:1236- 2759
Sequence
1523 bases(100 bases per row)
CTTCCTCCTAATCCACCCTTCTCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCCGCGATCCTCCTCCTCCCGCCCACACCCTTC
CTGTGGATTCTTCTTCATCCTCCCATCGACATGTCCAACTCACGTCCATGGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTT
ACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTTGTCATATCCACGCCAATACACC
AGAAATTCACGGTAAATCCGCCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAAGTCGTCGGCCTCGAGGTCCACATTCC
AACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCTACCCGGTCGGATCCATCCACCGAAAGACGGGTTTGCGGCCGATCTGGATATTCCTTGACCAACTT
CAGCTTGGATACGTGTACTACATGGAACAAGCGATATTCGGTACCTGCCGTTTCCACGCATGTGCTCCTATCTTTTCGCTTACCCGGAACGGTCCGTGCC
ATAGATGGGCCAATTTGCGGGCGTACCCTTCCTTCATCCGATCTAAATAAAGCCACACCTGCGATCTCACTTGATGGGGACGTCTTCGTTGTGTCGATCC
GCTCGATCCTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCAACGCCTTGGATCTCGGT
TTCTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTAGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTC
TTGGGCGGTAACCATCGCAAAGGGGAGTCGTTCTGCGTACTCATCCCAGTCCCTCTGATTCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTC
TGCACCATGCGCTCGACCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAG
ACATAAAACCTGGCTCCCGATCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGCGCAGTTCT
AGACGCACTGGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAAATGAACAATTCTGAGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGA
TCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGTCTGCCCTTGTCTGTCTCACAATCCACACATT
CACCGACGTATCGTTGCACACTCTTGAATAGTCCGCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAAGTCCCTGATGTCCACCTTCTAA
ACTAGCGTGATAGTGATGTAGGA