Description :
From Genome Similarity Track
Location :
Scaffold_1142:12357- 13576
Transcript NameFunction/comments
Phyta_totarag12203hypothetical protein

Sequence
1219 bases(100 bases per row)
TTCACCACGACCAGTACGTGCGTGTACACTACGTGCAGCAGATGTGGATATATCGGTTGGTGATGACCGTTTAAGCTccggcgacgaagacgactatcgt
gtcgatgacgacgatgaatCGGACGTTGAAGCTACAAGTGAAAGTTCggctggtgaagaagaagaagatacaagtgatgaagaagacgcagttgACCTCT
CCGCAGGAACTCCGTTTCACCAGATGAGCAAGGAGCAGTTGAGCGAACACGCATAGACCGGCTGGACTACCTACTTCGAAGATACATGTAAGTACTTTTC
TGTATTGGACAGGATAAGTATCATCCGACTGTAATGATTACCCTGTATTAGACACTAATTATTGAATGTATGTATGCAGGCTCGTCGCTTCAATTACCAT
CGTCTGAGCTTGCACGCTGCTCCGCCGCCCCTACAGACTTGGCTACAGCACTGGGAAGTAACCTGGAAGGGTTGTCCTTCCTGTTCCTGCCTAAAAAGAT
GTGGGTATCAGTTGCCACAAAATCCAACCGGTACCAGCTTCAATTTCGCACACAAGCGGCGGACGAAATAATGGCACGTCAGCGACGAATCAAGCTGAGA
CGCCGTGAGTACAAAATGAAAACGGTACATCAAGTCCAGGCTGAGCAGAGAGCGTTCAAGCCCANCGAAGCATTGGGCAGTGGATGCACAAGGTGCGGTT
CCCAAGGGGACGTTTGGTCGCTACATGGCGAGAAGGCGCTTCGAGGAGATTGTTCGCTGCTtgcacttcagcaacaaTCAAGACACTGACGCGCAAAAGT
ACAAAACCTGGAAGATCAAGCCTATCGCAGACACGATCAACGCAACCTCCAAACGTGGGATGACGGTCGGGCAGAGGATCGCCTTTGACGAAGGCATGAT
ACTGACAAGGAGCAAGTACAATCCGATGCGGCAGTACCTTCGCGGAAAACCCCACCCGTGGGNTCAGTCGAAGCGCTGACGGATACCCCGGTCCCTCGCT
CGTCAGCTCCACGATACATACTTCCGGCACGACACACGACTAACCAAGTCGACGTGTTTCGCATCACGCGCGGGAAGAATGGGAAGGAATACCAGAACCG
TCGCCAATACGGCTGCAAGGTGTGCTCATTGCTTCGTCTTGGCAAGAACCCGTGGGAAACAACCTTTACTGCGTGGAGTGCTCCGAAGCGAGACTGAGAG
GTGTGGCTGATGACAGCAC