Description :
From Genome Similarity Track
Location :
Scaffold_36:123444- 125008
Transcript NameFunction/comments
Albla_Nc14037000Amino AcidPolyamineOrganocation (APC) Family putati

Sequence
1564 bases(100 bases per row)
TCCAATGCACGATATTCTTTGCCGAAAGCCATTGAAAGTGATAAATGCCCAAGATGCTATCAATGAACTTCCACGCTCTTTATCGCTGTTTGATCTGATT
TGTATTGGGATTGGCGGCACTATCGGCAGTGGGATTTTCGCCACGACAGGAGATATAATAGCGAAATCGGCTGGACCTGCTGCAGCGATAAGCTGGATTC
TTGGAGGTGTTGTGTGTAGTGTGAACGCATTTGCCTACATGGAACTGACGACACGAGTACCGTCTCCTGGAAGCACTTATGCATACACATACCATGCCAT
TGGAGAATTCCCTGCAGTCATTGCTGCATGGCTGCTAACACTAGAGTATGGAATATCAGGTGCTGGAGTCGCACGAAGCTGGGCTGACATTGTCGAGAGT
TGTTTCCCGGTAGGAACTTATCACTGGGTGAACATGGAGTATGGCAGCATTCTTGGTGCCGCTGTACAGGCAAGCAGTGCCTTGATTCTACTGATTGGTG
TTCAATGCAGTAAAATGTTTGTCAACACATTTACGGTCGCTAAAGTTGGTGTCGTTATTTTTATTATCATTGCAGGATTTATCGCAATGCAGCCGGAATT
CCTGACGCCTTTTGTTCCAGAGCGTCAGATCATTGATAATTCTTCATTTTTTGGTATTCAGGGCATATTATCTGGAGCCACGCAAGCTTTCTTTGGTTAT
GTTGGTTTTGATGAGATTTGCTGCCTTGCAGCTGAGGCGAAAAATCCCAACAGAGTCATGCCAATTGCGGTCATAGGAACTATTTTGATCACTACGTTTC
TATCCGTCCTAGCTTCAATAGTGTTGTCTGGAATGATCGATTACCATGATGCCACCACATTCGAATCTGGTTTTGTAAATGTCGGCTGGAAGTGGGCTGG
CACAATTGTCACGATCGGAGAGATTATTACGATGCCGGTCGTTGTTTTGGTCGGGTTTCTAGCTCAACCACGTCTGAATTACGCGTTGGCGTGTGATGGA
CTCTTCCCCCAAATCTTCGCAAAGGTAGATGCGGATGGAAATATGTTTTGGAACACTTTGATCACTGGGATTTTCTTAACACTCATGGCGTTTGCCGTAC
CCTTTTCAACTTTGTGGGATATCGTAAGCTTTGGTATTCTCCTCTCGTTTATTCTGGCAAATTCATCCTTGATCCTCGTTCGTACACGATCAAAATCACC
GAATTTGGCTCCTGCTTTGACATATGGAATTGTGCTATGTAGCGCCTTTGCTGCTTTTGTTCTGCATAATGGGTATGAGGAATCACAAACAAGTTTGTAC
TTGGTCTGTTTCATCGCTAGCGTGGTCCTCGTTATGGTATTGAACATTATTATATGCTTCAAATGTCCTCAGATTGCCAGGAACACGACCTGCTTCTGGT
CTCCCTTGGTCCCGTTTCTTCCATCGGTCTCAATTTTAATGGATTGGTATTTGATCGCTCAACTCAGCATGACCTCTATATTATTGGGCTGTGCTTGGAT
CGGCCTAGGTGCAGTATTCTACTTTATGTATGGATTTCGCAATGCGTCAAGTCGTAGCAACTGG