Description :
From Genome Similarity Track
Location :
Scaffold_64:123435- 124874
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10783Hypothetical protein
Sappa_CBS223.65SPRG_10784putative arm-like repeat-containing protein

Sequence
1439 bases(100 bases per row)
TCCACCGCCCTGGACTTGCCGAAATACGAGCTGGTCGTCATCTTGGTCGCTCGGTCTTGGTGCTGGTCTGCTTTTTACAGTGCAGAGCTACCCTCTACAA
CGTAGCCGCCGTGCGGTCATGGTAAGCGTAGTGCCATACTTCGTGCAAGAAAATCAAGGGGTCCTTGACGTCGCGTCTCATGCGACAGAATGACCTGTCG
GTGCTTCGTTTAACGCGTTTACCCACCGTCGTTTCACGTTCAACGCGTTGTATCCAGAGTAACTGCACATGGCCAGCGTCGTGCTTGCGCTTCTGCTGGG
CGCTGCCGCCGCCGACCCGTACCTCGTCGAGTGCTTTTGCAACACGACCGTGACGTCGCAAGTCAGCGTCATGACGTCAGCCGAGAGCAGCACGACGACC
GCGGTCTTGACGCTGCCGACCTGCCTCGGGGACGTCTTTGGCACGACCGGCATTCGGTGGTACGTCAACGGGCCGTTCGACGCCGCGGTCACGTACTGGC
CGACCAAGACGGTCGAGTACAACGGCGACCGCGCCGCGATGCGTCTCATCCGGCTCGGGTACCGCTGCCAAAAGACGCAGCTGGTCGACGCCAAAGCGCT
GACATAAAATGACATTGGAATTGGTCTTAGCGGTGCTGCTTCTTGTACTTGATGAAGCGGAGGAGGTTGAGGCGCGTCTCCTTCGCGTGGCCGACAAGGT
CGCGGTCCAGCGTCTTGGCCTCGGCCTTGATCTTGGCCTTCATGCCCGCGCTCACGTGCTCGAGCGACGCGAGAAAGTTGAGGCGGAAAAACACCTCGTC
GTACTGCTCGTCGCTGTAGATATCAAAGAGCGCGTTGAGCACTTCGCAGACCACTTGGAGGTCCGTGTCCGAGAGAAGCGTCCCGAGGCACTGGCCGAGC
ACTTGGTTCTCGGCCAGCGAGTGCGGCTTCTTCCCAAGCGTACCGAGCACGCGGATCGCGGCCGTGCGCGCCTCGATCGACGCAGTTGCGTTCTGCGCGC
AGCCGACGACGAGCCCGAGCGGCTCGTTCGCACACTCGAGCGCGATCTTGTCGTCGACCGACCGCGTCACGATCGCACCGACCGCCATCATGCTAGAGCC
TCGATCAGACGCGCGTCAAGAGAGAGAGACAACTCGTACATGGCAGCAGCGACGTCACGCTCCGACGTGAGTGACGCGACGTGCGTGTACATGGTCATGA
GGTTCGCAAACACTTGAGTGAGCGAAAACGACGCCTCGAGCTCTACAAGAATGGACATTCCAAGTCCATGATCGTGTCCGTATGGCGAGGCGTACCGGCG
CGCGACGCCGCGAGCACCAAGTTGGCAAAGCAGCTGCAAGCACGTTCGCGGATGAGGCCAAAGTCGTCGGCAATGTCGGCGTGCAGCGTCGGCGGGATGA
CCACGAGCGCTTGCAGCATGGCATACGTCTATCAATAAA