Description :
From Genome Similarity Track
Location :
Scaffold_26:12343- 15660
Transcript NameFunction/comments
Phyca_LT153417201Hypothetical protein

Sequence
3317 bases(100 bases per row)
cttcccgaacgcttcgtcaaaaaaaatcaaaaatgacaatagtctccgtcgccaaatcccttgaggcttccagcaactccccaaagcgcggtaaaccgga
catcttgtgcttcacaccgacgagctctttcctcacccaaatagcggtcgaacacgtggcaaatccgcattattcgctgcctcgcgggctttgttcagca
aaagtgtttcaggcgcgaccggtcgatcacctccagttcggtgaggcactcgcgcacatgcctcggcgtgcccgacccgtcgtgcatgaacagcacctcg
tccataaggaccttcaagtccaagtgttgctcggagaacgggtggctcggcttgtggctcttgtacccgccaacatcttagggatcaacgacagcttgtc
cgccctcaccaggtcctcgtacgcctgtttgatgctgtgcagttgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagcgaggccctacaaatcctcggcagtcaccagtgcgtcaccgcggccgggcagc
gtcaagaagaaccacaacacgatcgggttcgcagacaagaagtacttggcgtgtaggaagtgctccttgtccgtgctgtgcaagatcgcgagatcgcccg
cgacagccttttcgacgttttgcaacaccttcttcgggtcgcccttcttcaagctgtccgtgatcttcgcgatgcccaccctcgacggggacaagccgcc
gccgcctccagacccgctaaccagcggtacaggctccgcggaccccccagccttgatcttcgggaactcgcccttgtccccgaagtagtgcacgtagcag
atcgggcgcttaaaacgcgagtggatgacgaccatcttgggaacgtccgcccagagcgtcttggccacggcaactgggtccgcgaggatgtggtcgccgt
gctgcaaggtgctgacgtcgcccctcagagcagatggcctcgcgaaatgcttcttgagcaacacggaccgcagcgcgctcatggccttgtcgtcttcgtc
cttcctcacccactcttccagctccttgaccatgctgtcgttgggcatgaggaacgtgttttggtaccgagtgctgcgaaacacgccgtccatggtcagc
atacaaatcacatcgtacaggtcgccgttggtcgccttggccaaggacaacaaaaaaaatactgattcttcttctttgtgccaactttacctccannnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaatgctttacgggacagctgttcagttacacgtacaagtggttacaccacttgtaactctaacagttgc
gctaactgttagaggttggaaacggacctcaggccttggtgtgtggagcacaccaatggatacatgggcgggccatatcattggatggctcgcgtgcatt
tacgcatgttattggtagaaagcgaagaatttctaccaatcagtgctcttaagagaaatcagaattctgtcaaccacacattgacagaacctttagaaac
agatagcaatcagatttaggaggtccataattggcttatgccaaattcaataacagttctcattttacggtatttgcagtataaatattgttatatttga
tttaattatatttacggacgtaagtataattaaattaagtctaattaattgcacgcttcctcatacacgtaagcgcacgtgtacgccacctaataggcct
tagtagacctattacacctggtagcactttgtagtccgtcagcgattcccaaaatgcggtaaaccggacatcttgtgcttcacgacggggaacccttccc
gaacgcttcgtcaaaaa