Description :
From Genome Similarity Track
Location :
Scaffold_98:12343- 13592
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12464PREDICTED: probable importin subunit beta-4-like
Sappa_CBS223.65SPRG_12465catalase putative

Sequence
1249 bases(100 bases per row)
TAGGCTGTCGACGACCGTCTTGCCTCGTCGTCGTTGCCGTCCGACGTCGCGCTGGTAATGACATCCATGTTAGCGTCGCTGGGTAAAGTAGCGCTTGCGT
ACCTCGAGTAGCTGGACATGGAAGCCTCGCTGCAGCGCGTGCTGCAAGAGCACGCCGACGAGTCGCGAAAGCTCGAATTGACGCTGCAAGGTACCGCACG
CGTCGACCTGCAACCAACCACGTGTTTCTACGGTGTGCATTGTTATTCGTAGTGGAACAAGCACGCCAAGCTCAAGACATTCAGCGGCGAAAGGCGCAGC
GCCGGCAAGAGCGCCAGATGCGACGGTCGTCGAAACCCCACGAACCTACGAGTGTGCCCACCGTGCTTCCGGCGCCAGCGCATTTGAGTACGCTCGTCCG
TCTCACGCAGCCTGCAATTAACGCTGCATGCAGGCGTCTGCCTCCCCGAAGGCCGCAAGGTCGACTTGATGCAATTGCTCAGTGAGACAGACGAGGAGCA
GCGACGCTCGCGGCGCGGCCTGCCCGGCAAAAGCGGCGGGCTCAATGTCACGAGCTTGATGTACCTCGCCAAGAAGATCGCGCCCAAGTCCAAGTACATT
GACATCGAAGAGACGTACGCGTTGTAGTAGGTTCTATAGTATTATGCCGCAGGCATGCTTGTGAGAAGATTTCTGGTTTCTTCTCGTCCCATTCATCATC
CGCACCTGGGAGCTACCTGGGAGTAGTCAGACGACAAGGTCGGACTGATGCGTGTCCGTCCATCTGCTCCTCGCGCAAGAGTCGTGTCCAGGCCGACCGC
TCATCCCGTCGACGCCACCACGGATACCACGACAGGTGACGGATGCCGACATCATCAAGATGAGCTATCAAGATGCGGTGACGAGAGATTCGCAGCATAG
CAGCGCGTGCAGGTGCGCAGAGACAGGCCGCTGCGTCAACAGTACTTGGGGCGAGGAGGCATACGCCCGTCTACCTACGGGTACCTCCTCAATTGCACGA
GGCGCACACTCAAAACGCAACAGAATAAGGTTAGTGGATTACAGAGACACAGCCCTCTATCATGCTCGCAGCATCCCGATCGAGTATTTAACAACGTGGT
CAAAGATCGGGCTGTTCACGAGTTCGTCGATGAGGTCGAGGTCGTCGGACGGCGGCGCCAGGAGCGGCTCGGGCGTAGCAATCGGCGTCGAGGCGGCCGC
GACGAGTCGGTGGTGCCGAATGCACATGCCTTCGCGCCGCGCGTAGGCG