Description :
From Genome Similarity Track
Location :
Scaffold_623:12341- 18987
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_623-fgenesh-gene-0.2Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_623-snap-gene-0.1160S ribosomal protein L26-1
Pytir_DAOMBR486maker-pir_contig_623-fgenesh-gene-0.5Gene of unknown function

Sequence
6646 bases(100 bases per row)
CATCGTCGTCCAGCTCGAATGCTCGGAAAGTTACATCCGCGGCTACAGCTAGCTCACCGCTGTCATTCATGTCTATTGAAGCAAAGAGCTTTGCAGGTGC
GTGCAGGATCCTGCAAACCGCGAAGACCAACCGCATCGTGATGAAACAGAACGCCGAGCACGCGCATTTCTTCCTCCGGCTCGCATTTTTCCACAACGGA
CAGGTCAGCACGATGCATTTTGTGGACCTGATCGATCTCAAGGACTTCAAGGAGGACCAAGCTTCAATTCAGGAGAAGCAGGAGCTCTTTGATATCTTCC
ACGAGATCCGACAGCCGCCCGTATCGTCACGCTACTCGATGATACCGCCTACCGTCGCCCAGGGACTCAACAGCAGACCAGGAGTAACTAATAGCGGCAG
CACTGGCAGTATGTCGGGGTCTTCCACCCCAAAGTACAAGACCCGAAAGATGATGCTGTCGAATTTCATTCTCCCGCTGCTGACAGCGAATGCCAAGACG
TTTCTCTATGCGAACGTGATCGACTCACGCACAAGTCTCCGGGAGAGCGTGCAGTTGCTCAACGCTGTTGCGAATGTCAAAGGGTTCTCGTGTACCTGCA
AGCGACTCTGTGGGGTCGAATTCATCCAGTTGGGGTTCCAAACCCCACCAGATGATGACTTTCTTCGCCAGAGCCACGCCCCAGACGATGAAGAGTTCAA
GCAAAACCTGTCGGCCCAAGATGCGACAGCAAAAGCATTGGCCACAGTTGCAATTGGAGAATCTCTCTTGAGTCGACTAGCTTCATCGTCGTCGTCATTA
GCGTTGCCACTGTCGAACTCGGCATCTTTTGGATCGATCTCGGTTCTGCCATCAGCATCATCATTTTCGATGTCTACTGCAGCGCCTCCATTTTCAACAC
CAAACATATCGTCAATACTGGCGTCTGGGTCTTCATCGCCTTTGGCATCGCCTTTAGTATCTAACTACCATCATCAGCATCCAGGTCAGCCAAGTCAGCG
AAAAGACTCGTTTAGCTCTGTGCCGATGGAGTCCGAGACGCTGAGCTGGCTCGAGTCGTTCTCTCAGCGGAAACGAGACATCCTAGGAGGCAAAATCGAC
ACAACCGTCCCGCTTCCCGTGTACCCTACGAGTCAGGACGTGGAAACGTCGCCAGCTCCAGCAAAGTCTACTTTCTTCAACTCAAGCGAAGGTGACAGCA
ATGGCAAAGGTTCGTTTAAACCCTTAAGGGGAGTCACTTTCTCATCGCTCGACTCTCCAAAGACAGAGTTCGGCTTCGAAGCGACCCAGATGGAGTCTCC
ATCAATAAGAGACATGGTTCAGCAGACCAGCGCTGATTTACTGCAGCGGCTTTGTGCTGCGATGGGATCAGCTGAAAAGTCCGGAATCAGGAGAGCAAGC
TCCGAGCCACTACCTATCACAGATGCAGATGATGACACTGGTGCGCATAACACGGCCAACTCTCGTGGTGCTGCTGCGAATACAACTGCGAGTACTCTGT
TGTCAACCATGGATAGTTCGGAAGGCCGAATCACGAATCTGGAAGATGAAAGAGAGAGGTGGTCTGCGCAAACTCCATTGCCATCGCAATTGACTGATCG
GTACAATCAGCGCAATACCCCGGACTTGGCGTATCCGACACCAGCCCCAGCTCCAGTTCTTCAATCACAGCCATCACCACGGTTTAGAGCACCAACAACC
AACCGCATGGGATCTTCCAACATTCAAACAGATGATGCCTTTGCGTCAAATCATGCAGACTACTGGGCAACAACAAGTTCAAATACGGTTCAACCCTTGG
ACTTTAATAGCACGACGGCAGCATCCAAATCAGTGTCTTTCTCGCGGCCACCAACTGCTGCCCCAAAACACGATGCTGCCGCAGTCCCAAGACCATCACC
ACTTTATCACCAACAACATCAGGAAAAACTTCTTCACGAGACTTTGGAAAGAGCCAATGTGCCGTCCCAAGCCATGGCGCCAGCGAACCTGGACGGACTG
GATGTTGTCACAGTCACTAAGATCCAGGCTACCGAGGCGGCGCTGCTCCGCAAAAACTACGACGCGCTGCTCACGATCGTCCAGGAGCAGCAGCAGCTGC
GCGAAGTTGCGGAAGCGAAAGCCACCGAGGCGATCCACGATCTCGACGAAGTCCGAGCGAGTTTCGAAGTGCAGATCGAGAACATGAAATTGTCAAATTT
GGCGCTGCGGAGCAAAGTGCGTGCGCTGGAGAAGCAGTCGGCGCTACCCAGAGTGTTTGACCAGTACGAGCAGGAGCTCCAGTTGCTACTCAAAGAGGTC
CAGCAGCTTCGAGACCGGAACGTCGCGCTGGAACTGAAGGTAAGCATTGAGGTTCTGGTAAGCTTAGTTGTTGTGATCTGACGCTTTCGAACATTGTCAT
CACATGTTCGTTGGCCTGTAGATGACCGAAAGTGATGGATACAGCGGTCCTGGATCTGCCCATGAGCTGAAAAAGAAATACCAGGCAGTCGTGGACGAGA
AGCAGCAAATGGAGAAGCAGCTGCTCGAATATCGCAAGCGAGAGCGGTGAGTGTTTGTGTGGGTGACAGCCCTCACTGACTTAAAAAAGCGTTCTCGTTG
CAATGTGCTGACTTGGAAATCATTTTCGTAGGCAATTCATGGTACACAGCAAGCTGGCCGACGATTCCACGAGGCGTGTTGACCAGCTATCACGGTGAGC
GACGCTTTGAAATTGCCTCTTGTTAGTGATCCAGTACAACTTCGTTCAACCGTTGTTAACAATGGGCTGGCTGAATATCGATGCAGCGAGCTCACCAGCA
AAGACGAAGCGCTGTTGGCAACAAAACTGGGCAAGTTGCGCATGAATGCCGAGATGAACCTGGCCCAGGAAGAGGCGAATCTGCTGCACCAGGAGAACGA
AAAGCTGCTGGTGGAGAAAGCCGCCGCGACGGAAGAGCTGCTCACCACGAAAATGTACCTGGCATCCTTGGAAAATGTACGTTGCTTATGCTTGATCATC
TTTCAGGCTCTACCCGTAAACTGACATTCTCGCACTCCCTTTTCCTAATGAAGGAACAACGGAAAGCCGATATCCTCGACAGGTTTGTCAAGAAGCATGG
CGACCGCATGAGCCGCTTGAAGAGCAATTCAGCAGTTTGCAACAACAGCAGCTTTTCATCTTCTTCTGAGATGTGGTGCCGTGATGCCTTTGCAAAAGAT
TGCGAAGAGAAAGTGTTTGCAACCGTGAAGCGCTCGCTGCCGCAGCTCGTGCCGCTGGTCAACAAGCTCCTGCGGCGCCTCGAGATGCAGGAGCTGTCGC
TGCGTGAGTACTCGGAGCGCGAGATCGACTTCATCAACTTGCTGGTGGAGCTGGTCTCAGACCAACCGGCCGTGTCGCTCAAGAACATGATCCAGCAAGA
GATGAAGAAGCTCACTTAAGGACGACTCAGGCAAGGAACGCGCCATAGCCATTAAGGATACAAACAAAGGTATGGTGAATAGACTGGAATTCCCTCTTTC
TTTAGATGATTTAAAAGATGATGACCGAATAACCTGCGACTTAGTCGACGTTGGCCTGGGCGACATCGGCCTCGGTGAACTTGCCCTTGGCGTCGTCGCC
AGTGGCGCGGTTCTTGCGCTCCAAGATCTTCTTGCGGTCCTTGTCCAGCTTGAGCTTGGAGATCACGACCTTCGACGCGTCGAGGCCGATTGGCACGGCC
TGGCCGTTCGCCTTCTCCTTGACGACGCCCGCGACGTGGATCACGAACTTCTTACGGTACACCGCGGTCACACGGCCCTCACGGTTCTTGTACGTGCCAC
GCACAACCGTCACTTCATCGTCCTTGCGGATTGGGATGGAGCGGACCTGTAAAGAGCATCAACAAGAGGTTATCACACACGTGAGTATCACAGGTCTCAG
ATATTGCATAGCCAGGTACAGGGAGCATTAAAGCGAGCGTCATCGATCCTTATGTGGGCAGCCCACACACACAGCCGTCTCATTCAAGACGGCAGCACGC
GGTCTGGACCCGGTTGAGATCGGCACTTACATATCACACGATGCCATGAAGTGCCAGTATTTGAACGGAGCTCCTCGCTATGGCAGCGAGAGAGCTCCAC
TGACATGGACTTACACGCTGAAAGTATAAGTGTAAGCTGCCCGGTGAGAGGCAAACTCCACTAACTTACATTGTACTTGTTCTGCAAGTCCTTGGACAGA
GGCGCGCTCATCAACACGCGACGCTGGGTCGAGTGCGCACCGAAGTGAGCCTTACGGCTTTTGCGGCGGGAGGAGGAGACAGTCGAGTTGAACTTCACTG
CAATGTCGCAATAGATACGAGCACACAGAATAACACGTTAGACATGCTGGTCTTCATACATACATTCGTTATCGAAGAAGCTTGTCGTGGAGACGGTGAT
GGTGGTGGCCGCGTTCTTGTCATGCAAGCATCCACATGCGCCTCATTCGGTACACACAGGCAGGCGCACACAAGAGGGCGCGCCCATTCATCACCCATCC
ATCCATCTCCACACACATATATAGGGGAGAATCGACCAGCATCATCACGTACTTTTGTTATCAGGCAAGAAAGAGATACTGAAACGCGCCTCATGCTGCC
GCTCCACATGCGCTCAAGTCGCCCGCGCGCTTCTCAACAGCCAGCCAATGGTTCACCACACAAAATGTGCGCCACAAGCCAGACGAGGACGGTTCAGAGC
AGATACGGTTCACTGAACCGTGAACCGCGGGTGAAGGCTTGCTTGGCTCAAAATGTCATTTACAAACAGCTGGGTGATTGCCTGTATAAAACAATATCTT
TTTGAGAGTATTAGACATATAGAAATTAGCAGGGTGCCGTGATGTGTCATCAGATCTGATTCCAAGAGCTCCAACACGAATACGAATAGAGTTTGCTTCA
CCGCGATAAAACTTCTGGCTTCTGCTCGCTCCTGCGATGGAGAGCTACACGAGGGTTGCAGTACCAATTGCAATGCGCACGGAGTAGATTCGTTCAGCTA
CTGTCTCACGAGCGAACTCCATGAGTGGCTGGCTACGAGTGGTTCGTCCGATCACAGTGCTTCAGACCACTTTCGCGTGATTGAACCGTGATAATTGACC
CAGGAAGTCAATCCAGTTCCAACGAAACTGGTTGCGATGGTGATGAAGCATTCGGAAAACAAATCTCTACTCTTGGGTTGAACACCGCATTAGAACCTCA
TTAGTATTATGAGAAACTGTCACATTGGGGCTACACTTTTCGGTCATCTACAGCACTGAGAGAAGGACGACCTCCGCGACAGCAAGCGCTGCACTTCAGA
TAAGCAAATTACATTACACTGATTATGGGTGCTTTTCTATTTGCTGCTACCTAGCGCTGCACTCCAGAGTGCGCAAACCAATGTCGATCACCATTCGCAG
CAGTTGATGATAAAGCTGAGACCTCGGCTTGGCGGGAAGATTCATGGTCATCGGCACCCATACACTGGGCTCGGGGTTTTCCACTCCCCTCCCCCAAAAG
TCCCGATCGTGACTATACACGCCTCCCGAACTCCTGAGACCGCCTTTGCTTTCTTCCTCTGTGGCATTGAAAGAGCGACAGCACCGACTGCTATTGCTAA
CGTTGTAGCTCCCCCGAACGAATGTTGAGCAGCAGCAGCCGAAATCTCCATTCTAAAAGGTCTGATCTGGCCATTTTTGGGGGCACTTTGTATTCAGGGC
ACGAGGTCTCGTCGGTGGGGAAAATCCCGAAGTACGATGTGCCAAAGCCGGGTGACTTGATGCAGATCCTGGACTTGGCGATGAAAAGCGCGTATGCGAG
CTGGCTCGGCGGTCCTGTGAGCCCCATGAAGTCACCCGTGAGCGCCGAGGCACCGCCGTAGCGTAGATGATGCCCTTGATCTGCACTTGCATAAAGCCCA
TCCCCGACACTTTGAAATCGGCATCGTCCACGTAGAACGCGCTGTCCTTTGTAGACACGAAGAGGTTGTCAGTGCCGTTGAGCAGGACGCTCAGCGAGTC
GTCCGAGCGTGTCAGGTTCAGGTTGTTGTACAGTTGGGGGCTCGCACCTGAGGTTGCGTTCGTCGAGATACTCTTCACGTCGACGGCTGACAACAGGTAC
ACAGCGGCTGTGGCGTTTTCGGTCAGCACGTGGATGTGCATAGTGTCTTGCGCTCCAATGACTTCCGCCTGCCCACCTTGAGCTAAGATCGTGTCGATCG
ACCCTTCAGGAAGCATGTCACCGTTGACCCGGTTTAGGAGCACATACCCAGGACCAAATACGTTGATGTTTAGCGCGATACGGTCATAGACTGAGCTAGT
GTCGACTGGGCTGATCATCCAACTCGATTCAAGCTCAGTTCTTTGTCCAACTGCGATGTTCCGGCTAGAGAGCTCTTGGATAGTGACGCCTCCAGTAGCA
GCAGCAGAGCTCGCCGCAGTGACGAGCAGCGACTGTGTCTTCTTCCTGTTGTCGAAGAACGAGTAGTCTTCTTTTTTTCTTCATGAAGAGCACGTCGTTC
GAGATCACGACGTCGGCCACGCCATTTGCGATCACTTTCTTGAGTGCGGTCTTCTTGAAGAGCGCGGTCTCCGTCAGAACCGAGATGTCACTGGAGTTGA
TACTGGAGTTGGCGCTGCTCACGACGATCTCTGAGCTCTTCACCGC