Description :
From Genome Similarity Track
Location :
Scaffold_59:123401- 126894
Sequence
3493 bases(100 bases per row)
CCGCCCTGCTAAGTCCGACAGAACATTGGTGGGTCATGTTATCACTTCTGTCAGGCCTTGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCATCCGGC
ATATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAGGAGGCGCTGGACAAGTGGGTAACTTAGGTCCAC
AAGCGGGTAACCTAGTTCCGGAGACAGCTGCAGCTGTCACGAACACTGACAATAACGTGTTCAGGGTGGGTAATAGAGTTCCACACACGGTCGCCCAGAC
CTAAACCGAAGCGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACATAGTGCCACACGCGGTCACCCAGACCTTAACTGAAGAGGAAGACGTCGAACTC
GCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGAATGTCGGCGCTCTGACATCCCCAGACTTGTATAACTAAGCTCCACGTCATG
GTCTTCGTCGACGACGACGCCCCCGCCGCCGCCACAAGTCCGATCTGAACTTCGTTCAGATCAACGTCGCTTCACGCGACTCAGTGTCCAGGGACCGGGG
TCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTCTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAG
GTCCCAGAGATACTGAACCTCGAGGAAATGACGATCGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGA
CCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACTAGAACGTCCTGGAAGACCTGAACAAGCAGCGTCAGACGCGCTTGGGCTCCGAGATCCTGAA
GAAATTCAAGGATCCCGTATATCCTTTGGTGACGGAGTATGCTGATGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCAAGGCGTACGGCAT
GAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCTCGAGACAATGGCCTCTCCCGTGAGAACAGTGCGAGGTCATTGATGCATTCTTCACTGCGAAAG
CGTAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACGCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCCGACTCACGCTTATAA
CAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATTCCACGAAAGGATGTGTTTTTAAACAACATGGTCGGAAGCGTACGGTACAGTGAATTTGGT
AGACGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGATCACCGTGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAG
GGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTAACGCAATTGTTCCGCCCACTGCGTACCTTCGTACAGACGTACTTCGGCGACATATTCGTCC
TTAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACAT
CGACAAGTGCGTTTTTGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAGCGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAACA
GCATGGCTGACGCCCCGATTCCAAAAGGATCTTCGAAAGTGGTTGGGCTTGACCAACTACCTTCACAAGTACAGCGCAGGGTACGCGAGCTTCGCTAAGC
GCTTGTCGGGATTCCTTCAGAAAGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCCTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCTGTC
CTGGCCCTGCCGGGCGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCTGGTGTGCTTTGCAGCAGGCCGACACGGCTGGACACC
AACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAA
GTTCCGTGTTCACCTTCTGGGCTCTAGTCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTGGCCTCACCTCTCCCAAAGGATG
GCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAGTTCAAGCCGGGCAAACTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACT
ATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGAGACGATGAGGCTACCGCGCCTATCGTCAAGTTCCT
TATGGCCGGAACCAGCGCAAAGTCCGACTGGCTCTCGTCGCGGCAGCGCTCACGGCTCCATCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTG
GAGCCCACGGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTTGACATCCTCGCGAAGGCACATCACGCGCCCTCCTGCGGCCGCTTGG
GCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTATAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCG
GGTCAAACCCGCGGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGCGCTTCCC
GCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAG
CCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGTTTGTCTCGGACCGAGACTCGCGGTTCACCGCTGCGTTTTGGAAAAC
GCTGTTCCCTTTACGGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACG
CTGCGCAGTGTGGCTGCGGCAGCACCACGTAGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCAC
GCCGTTCTACTTGAGCGGCTTCCGACACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGGGGAGGCTCGGAAAGC
CCTTTCCTCCCAGGTCTCGGATGTGAGATCAGTTTCGCTGCGGAAACAGGTGAAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGTTCCGCGAT
GCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTA