Description :
From Genome Similarity Track
Location :
contig_73:123377- 124826
Transcript NameFunction/comments
g11721.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
CACACTGCCAGATAGTCTCCGCCCTCGGCCATCTCAAAGTCAAGGCCAGGGCCACAGCAACGTGACATTCATAATAATAAGGTGGGGTGTATTGTATTAA
CCTTTCAGTCCCCGAACTCTAATAAATCAATGGTGGTCTTGCTTGAGCACGTCCAAGATGCGCTCGTCCGAGACTCGCTGGAAAAGGTCATATCACTCAT
AACTGCGGTCATAGCGACCCCTGTTTAGCAATCCTCAAACGTGTTGAGCCAGAACTGCAGTGCCCTACAGCTGGACGCGTGACAAGACCAAGCAGGAGTT
TTTGCTGTCGAGCCTGCATTGCGTTGAAGTTGGCTACCAGTAGTCGGCGGTCGGTCTGCGTTTTACGCGCAAAAACAAGTAACAGTGGTTCGTGAAGAAC
GTCACGACGGGGGGTGGGGGGTCATTGTCGGCGGTGCTGTCTTTTTGCTCGCCGTCCCTGCATTCACCCTGCCGCTGTGGGGCTCTCGGCTTGGCACTTG
CAGGCTTGTTGGCATCGTGCTCTGTTCGCTAACAGCATCGGAACATTAGACACCTCGGTCGGCTGCTCGCCAGGTATTAAACGGTGCTCAAACTTTGAGC
ACCAGCGCCTCGATGCCGATATCAATCAACGCCCACTCAGCAACGAACAAAGACAACAGACACGGATACTGATCTTACCAATGAGGATATCATGACCACG
GCACGGCAGCACAGTTTGTCAGGCTGGACCAGTTGCAGAGGACGAGAGGTATACAGAGCAGCTCGATCGGTCGCGAGAGTTCCGAGTCACGCGGTGGCAG
CGCGTTTCTCGGTGCAGCGACAAGCAGGCGGCTTCGCTCAGACCCTCGGTTCAAGCAGCCCGACGGGTTCCATGGATGCCCACACCAAACAACAGTAGCG
GGTATCTTGGTATGAGGTGTTGCTGACGAGCTCTCGTACAATAAATCAGTGGTGTGTGTATTATTTCTCTCGTCAATTCATCTGACCACCCTCCCAGTTA
ATAATCCATGTGCTCTTCCTCTTCGTCGTCGTCTCCTTTTTTGTATCGATGCGCCCGCTGTCGCCGCCCTAGGTGAAGTTGCGCGCCATAATGTCGTCTC
CGTGCGAGACCACCAGTCTGTCGTAGGCCTTGGCCGCGTCCGTGGGCGTCCAGAAGTCGCCGCCCACGATCACGCGGCCGCCCACCTCGAGTTCGGCGCT
GTACTTCTTGATCTTGGCGGCGTTGAAGCGCACGCCCAGGAACTCGTTGGCCGCCTCGTTCTCCGTCTCGGCCACATGCACGTCCTCCACGTTGCAGCTC
TTGGTGATGGCGCGCAGTGCCGACGTCTGCAGCGGACGCGCGAGAGCGACACCGTTGACGGCCATCTGCCGAGCCGCTTGTCGGCCGAGCGGCACTTGGC
TCTGTAGTCGAAGCACGCGGTGCAGAAGCTGGGGGTGCATGTCAGCTGT