Description :
From Genome Similarity Track
Location :
Scaffold_14:123374- 125358
Transcript NameFunction/comments
Phymu_g1039hypothetical protein PHYSODRAFT_310528
Phymu_g1040hypothetical protein

Sequence
1984 bases(100 bases per row)
GAAAGCGCTGCAAAGATCACACAATTAGAGGCccgcaaccagcagcacgaagcagaCAAGCACGCCCTTcaggtgcagctggagcttgcTCGGGGCCAAG
TGGCGCATCTGCAGGACCAACTCGCTCGTACTCAAGAGCGTCGAACTACTCTCGAACACGTACGTCATTTCAATCCGGGACTTGTTGGAATTACGTTTCT
TGATTCTGGAATTTTGAGAACAGGCAAACCAACAGCTTGAGCAAGAGTTTACCAGGCATACCACAGCAACACAAAGAGTAGGTGGTCTTTCCTTCACAAA
GCTTGGCTTACCTTGAAATTTTTACGTGATTTTGTGTTGTCTGCAGTTTGCAACTGACCTACAAGCAGAGCTACGCAGACGTTATGGGTACATTTCCATC
GCACGGATCGTGATTGAGCCAGGACTGACCGTAATGTTCAGTGTTGTGCCTTCAGTTCTGGATGTGAAATGGCAGCACTATTTCCCTGGACTGAGTCGAC
CATTCTAACGGCGAAGGAACCAACACAACACGCACGAATGCAAAGGCACAAAGCAATGTTACTCACTTTCACCCATTCCTCGTTGACAATCCCGAGCCAG
ACAGTTTGCTGGACCTCTACCAGACGCTGAGTGCTTAAAAAATGCTGCGCTGTGATTCTTGCTCGCCATCGAATTGTGTTGCTCTTTTTTTCTCTGTACC
ATGCTTGTTTGCCGTGCTGATGTCTTCAGTCTTCCCTGTAAGATTCGTGttctccttcctctccgCGCGTTGCCCGTCCGCTTTTCACACCCTTCATCGC
CCCGTTGTCAACATCTTGCACGGTCGCTTGAAGGCTCCAGATAAAGCTGGAAATCTCGGCATCGCGTGTTCTCGTCTACTTCTTGAGGCCCTTGAGCATC
TTTTGCCGGCGGCCGGTCGAGAGCTTGTTCTGCACGAGGAAGGGTGcctggatgctgctgaacTTGTTCTCATTGCCCGCACTCCCAGCGCCAAGGCCAC
GGTCGCTGCCCATCGAGTTGACGCTCCTACTAAGATTATTACTATTTTGCCCACCCATCATACCGTTTGCACTGGGAAGCGACGAGCCCGAGTTATACGA
CTGCGCCACCGGTTGTTGGGCAGGCACCGGTGGAGGGGGGGCTCGATTCTGCCGCCATGTATATGACTCTTGCGTCTTTATCACCTTtcgttgctgtggt
tgtTGCTGAGGCGGCGGTGGAGACGGCGAAGGCGTTCGCTGCTGATACTGAAccggtgctggtgcaggtgacggaggtgctggagcacgagGCTGGCCAC
CGCCAACGTTACGCACTTGGAACTTGAGCGTCAACGGTTTCTGCATCACCTTGAGCAGAGTCATCACCTCCTCGAAGGACTTATCACGCACGTGCACGCT
GCGGCCATCCACTGAAATCAGGCAGTCATTCAACGCAGTCTGTGGCAAATGTGCAGCACTTCCTGTACCCGTCACACGAGTAATGTAAGGGTACTCGCAC
GTATTATCAGCACCACGTAAAGACAAACCCAGCGGCGTGCCGTCCTGCCATACCAAGTTGTAGAACTGGACACCGTTGTCctcgcctgctgcagcgagtg
CTGCCTTTCGGCTGTGGCTTGGGGTAGGCGTTTCGTAATGAATAGAGGAACTTCCACTCGAGGTTGACGAGTAAGATCCATGTCGCTCGTGCTGCGGTTG
AGCAGCCTTGCGCCTGAAGAAAAGCGTCACCGGACGGGGTACATTCTTCAGGTGCGCCACGATGTCCTGGAAAGCCACTCGCGACACGTCCATGTCGTTG
ATGTGCGTCACATCGTCGCCAACGCAGTCTTGAGAAAGGTGAGCCGCTGCGCCTTGAGAAGCAATGCGCTTGATAAATGCACCCGTCGCATTTGGCTTTG
CGTCGATCGTAAGACCCAGCGGGCCTGACCCCCACACAACCTTGTACACATCGCTTGGTGCCTCGCGTGATACTTGTCTCACAA