Description :
From Genome Similarity Track
Location :
contig_3:1233627- 1236073
Transcript NameFunction/comments
g1162.t1ETM03229.1 hypothetical protein L917_00531, partial [Phytophthora parasitica

Sequence
2446 bases(100 bases per row)
CAGTGCACAAAGCAAGAGAATACCGCTGATATCCAGGTCTGCCGGTCTCCACTCGCCCTCTTGCTCATCGCCTCCGATAGTGTCTTCATTGCTTGAATTG
GCGCATGACGAATTATCTAACGACGCTCTAGCCTCCTCTTTTTGAGCCAGATCCATTTCCAGCAGACCGAGGAACCACGACGCAATCTCCTCCTCCTTCA
CATTCAGGGTCCTTCCAGTGCTTTCAGCAAACGCGTATCCGCATGCTCGTATTTCTTCCTCGTTTTGGCGTTGGCCCTCCGTCTCGGTATCCTCTTCGTT
CTGGTTGGTGGCCGAACGCTCATCTTCTGGGTCACTCGCAGGGGCACAATTGTTCTCGCCGTCATTCTTCAGTCTTGTAGTGCTTGAATTGGACTCCCTG
GAAGCATCCACTGCTTCGTCGTTATCGTCGCACCGATCAGGGTAGCCGTCAAAATCCGTGTCCAAGATCGCATTGAGCAAGTGCGCGTACCGGACTAGCG
TCGTGTTAGGCGCAGCGCCTTCACGAATCTTTTGTCGGACAAACCTCGCCACACATGCGCGGCGTTCCGTTTCCGCCACTCTATTCGGAGCCTGCACAAC
AGGATTCGAGACTGCTGCCGATCCAACTTCCGGGGAGAGTGGAGGTGCAGGCTCTGATTGTGTTTGGCTCACTCCACACAAATCCATCGCACCTCTGGTG
ATAAGCTCAGACCAAACAGCATACGGCTTCTTCGTGACAAACGGGTTCGCTGTACCAACCAAAACCTGGTAGTCCCCTGCTTCGGGGCTTGCTAAAGCTG
ATCGAAGCAACACGGTCTTGCCCACACCGATATCACCTTCTAGGATAAAAGCTTAAAACCAATGTTCAAATCGAGTAAAGCCAGCACCTCAGCATTTTGT
CAATAATGCGATCTACAGAACAGCATTTCATTACTCTCAGGTAACAATGACTACAAACAGGAGGTAAATTCATTATTCCAATAGGAGTCGAAGGGATCAT
TTGAAAATTGAGTACGTGGTCTTGGTTCACTCTAAACGTTTCAGTACCGATTACTCTAGGCCTTAGCTTCCGATCCAATCGAATTGAAAGGAAAAGTCTA
CACTAACACTAACACTAACACGACCACGACCACCGCGACGCCGCAGATTGCGGACGCAGCGTCGAACAGCAAACCGATGAGTGCGAGGCACGCGACGAAG
CTCAGCAGGGCCTCGAAGAGCCAGGATCTCTACTGAAGACGCGTTCTGCGTCCACGCTCATGAGAGTGAGTACTTTCCCCGTCGTGAACTGCTGTTTGGC
GGCACTGGAGAGCCGCAGACTCTTGTGGAAGATGCAGGTCATGCATAACCAGCGACCGCATGCTGGCGCCCGCTCTGGACGAGAGCAAGAAGGTAAAGTT
GCGGCAGCTGATAACCACCACCGAGACGGCGGCCAGGAGCGCCACGAGCGCGTAGCCATTGGCAATCTGGAAGACGTCGACGCGTCCGTTGATCCTATAT
CGTGAGACTTGCCACGATTGGTAGAGGGTCGAAATTCTGCACCAGCAAATCGCGATATACGGTTGGGGTCGTGCCATTTTCAATAGTCCTCGCACGTACC
GGTACGTACGTGTTGTCATACTTGTTGTCGGACGTCGATAGTGATAGACCAGACCTCCGTAATAGTGGCAAAAGCCGGAATGTGTCGTATTAGCTTTATT
TCGGCATCTCCATTATCTCTTTTCCGGGACTATGCCACTTTGAAGCTATCCTGACTGAGTTTACCAAGCGTTCGTTTAGTTGATCGAACTGTTTATCCTG
AAAAAAAAAACCTCCAGTGGTAAAAGAGGTCAACGCTGTGCGACGGTCGTCCACCCCCCACTTGAGAATAGAGAAATCCAACTCGACCGGCACCGTGTTG
GCGAATATAATTGCTAGACCATAGCAAAACTGTCGGAGATACGAAAATGTATGTGGCCCTCCCATCCACCATTGAAATTGGTTTCGTAGTTTGCTTTGTC
AAGTACTGCCTTGACGGAATCGTTTAGCATATTTGCTTAGCACAACTCTCAATGCTCCATCCCACAGCTTCCATTTGAGCTCGATTCCAAAACTTCGCTA
GATGGCTGCGACGAGGGCCCAAAATATCGCCTGTGAACTCACGCGGAGGAATTTGAGCAAGTTCAGACGGGATCACAGGCGGTGCAACATTTTGATCAGC
TGCATTGTTGCTATTCCTTTCTGCTTGTACCAACTCCATCCCTGCAGCTCTGCAGTATGGCGGTTGAACACGCGAATGGGGAACATTCGAAGGATGTTCG
GGTTTCCGGATCGGCGATAGGAGTTTCGAAACTACTTGTATTCAGGTCAGAGTGGGAGGACGAGCGGCTTTTGCGAGAAACAGTTCGCAAAGGCCACAAT
TCTGTTCATTCTCGAGTTTTCCTCGCTCCGATAACCCGCCTCTCCA