Description :
From Genome Similarity Track
Location :
contig_3:1233611- 1236057
Transcript NameFunction/comments
g1254.t1hypothetical protein

Sequence
2446 bases(100 bases per row)
AAGAGAATACCGCTGATATCCAGGTCTGCCGGTCTCCACTCGCCCTCTTGCTCATCGCCTCCGATAGTGTCTTCATTGCTTGAATTGGCGCATGACGAAT
TATCTAACGACGCTCTAGCCTCCTCTTTTTGAGCCAGATCCATTTCCAGCAGACCGAGGAACCACGACGCAATCTCCTCCTCCTTACATTCAGGGTCCTC
CAGTGCTTTCAGCAAACGCGTATCCGCATGCTCGTATTTCTTCCTCGTTTTGGCGTTGCCCTCCGTCTCGGTATCCTCTTCGTTCTGGTTGGTGGCCGAA
CGCTCATCTTCTGGGTCACTCGCAGGGGCACAATTGTTCTCGCCGTCATTCTTCAGTCTTGTAGTGCTTGAATTGGACTCCCTGGAAGCATCCACTGCTT
CGTCGTTATCGTCGCACCGATCAGGGTAGCCGTCAAAATCCGTGTCCAAGATCGCATTGAGCAAGTGCGCGTACCGGACTAGCGTCGTGTTAGGCGCAGC
GCCTTCACGAATCTTTTGTCGGACAAACCTCGCCACACATGCGCGGCGTTCCGTTTCCGCCACTCTATTCGGAGCCTGCACAACAGGATTCGAGACTGCT
GCCGATCCAACTTCCGGGGAGAGTGGAGGTGCAGGCTCTGATTGTGTTTGGCTCACTCCACACAAATCCATCGCACCTCTGGTGATAAGCTCAGACCAAA
CAGCATACGGCTTCTTCGTGACAAACGGGTTCGCTGTACCAACCAAAACCTGGTAGTCCCCTGCTTCGGGGCTTGCTAAAGCTGATCGAAGCAACACGGT
CTTGCCCACACCGATATCACCTTCTAGGATAAAAGCTTAAAACCAATGTTCAAATCGAGTAAAGCCAGCACCTCAGCATTTTGTCAATAATGCGATCTAC
AGAACAGCATTTCATTACTCTCAGGTAACAATGACTACAAACAGGAGGTAAATTCATTATTCCAATAGGAGTCGAAGGGATCATTTGAAAATTGAGTACG
TGGTCTTGGTTCACTCTAAACGTTTCAGTACCGATTACTCTAGGCCTTAGCTTCCGATCCAATCGAATTGAAAGGAAAAGTCTACACTAACACTAACACT
AACACGACCACGACCACCGCGACGCCGCAGATTGCGGACGCAGCGTCGAACAGCAAACCGATGAGTGCGAGGCACGCGACGAAGCTCAGCAGGGCCTCGA
AGAGCCAGGATCTCTACTGAAGACGCGTTCTGCGTCCACGCTCATGAGAGTGAGTACTTTCCCCGTCGTGAACTGCTGTTTGGCGGCACTGGAGAGCCGC
AGACTCTTGTGGAAGATGCAGGTCATGCATAACCAGCGACCGCATGCTGGCGCCCGCTCTGGACGAGAGCAAGAAGGTAAAGTTGCGGCAGCTGATAACC
ACCACCGAGACGGCGGCCAGGAGCGCCACGAGCGCGTAGCCATTGGCAATCTGGAAGACGTCGACGCGTCCGTTGATCCTATATCGTGAGACTTGCCACG
ATTGGTAGAGGGTCGAAATTCTGCACCAGCAAATCGCGATATACGGTTGGGGTCGTGCCATTTTCAATAGTCCTCGCACGTACCGGTACGTACGTGTTGT
CATACTTGTTGTCGGACGTCGATAGTGATAGACCAGACCTCCGTAATAGTGGCAAAAGCCGGAATGTGTCGTATTAGCTTTATTTCGGCATCTCCATTAT
CTCTTTTCCGGGACTATGCCACTTTGAAGCTATCCTGACTGAGTTTACCAAGCGTTCGTTTAGTTGATCGAACTGTTTATCCTGAAAAAAAAAACCTCCA
GTGGTAAAAGAGGTCAACGCTGTGCGACGGTCGTCCACCCCCCACTTGAGAATAGAGAAATCCAACTCGACCGGCACCGTGTTGGCGAATATAATTGCTA
GACCATAGCAAAACTGTCGGAGATACGAAAATGTATGTGGCCCTCCCATCCACCATTGAAATTGGTTTCGTAGTTTGCTTTGTCAAGTACTGCCTTGACG
GAATCGTTTAGCATATTTGCTTAGCACAACTCTCAATGCTCCATCCCACAGCTTCCATTTGAGCTCGATTCCAAAACTTCGTTTGATGACAGCGACGAGG
GCCCAAAATATCGCCTGTGAACTCACGCGGAGGAATTTGAGCAAGTTCAGACGGGATCACAGGCGGTGCAACATTTTGATCAGCTGCATTGTTGCTATTC
CTTTCTGCTTGTACCAACTCCATCCCTGCAGCTCTGCAGTATGGCGGTTGAACACGCGAATGGGGAACATTCGAAGGATGTTCGGGTTTCCGGATCGGCG
ATAGGAGTTTCGAAACTACTTGTATTCAGGTCAGAGTGGGAGGACGAGCGGCTTTTGCGAGAAACAGTTCGCAAAGGCCACAATTCTGTTCATTCTCGAG
TTTTCCTCGCTCCGATAACCCGCCTCTCCACGCCCTTACTCCGGGT