Description :
From Genome Similarity Track
Location :
contig_73:123338- 126532
Transcript NameFunction/comments
g11721.t1hypothetical protein
g11722.t1hypothetical protein

Sequence
3194 bases(100 bases per row)
TAAGCAAAACACAACACCGAGCGGCTGATCTCGTGTTGGCACACTGCCAGATAGTCTCCGCCCTCGGCCATCTCAAAGTCAAGGCCAGGGCCACAGCAAC
GTGACATTCATAATAATAAGGTGGGGTGTATTGTATTAACCTTTCAGTCCCCGAACTCTAATAAATCAATGGTGGTCTTGCTTGAGCACGTCCAAGATGC
GCTCGTCCGAGACTCGCTGGAAAAGGTCATATCACTCATAACTGCGGTCATAGCGACCCCTGTTTAGCAATCCTCAAACGTGTTGAGCCAGAACTGCAGT
GCCCTACAGCTGGACGCGTGACAAGACCAAGCAGGAGTTTTTGCTGTCGAGCCTGCATTGCGTTGAAGTTGGCTACCAGTAGTCGGCGGTCGGTCTGCGT
TTTACGCGCAAAAACAAGTAACAGTGGTTCGTGAAGAACGTCACGACGGGGGGTGGGGGGTCATTGTCGGCGGTGCTGTCTTTTTGCTCGCCGTCCCTGC
ATTCACCCTGCCGCTGTGGGGCTCTCGGCTTGGCACTTGCAGGCTTGTTGGCATCGTGCTCTGTTCGCTAACAGCATCGGAACATTAGACACCTCGGTCG
GCTGCTCGCCAGGTATTAAACGGTGCTCAAACTTTGAGCACCAGCGCCTCGATGCCGATATCAATCAACGCCCACTCAGCAACGAACAAAGACAACAGAC
ACGGATACTGATCTTACCAATGAGGATATCATGACCACGGCACGGCAGCACAGTTTGTCAGGCTGGACCAGTTGCAGAGGACGAGAGGTATACAGAGCAG
CTCGATCGGTCGCGAGAGTTCCGAGTCACGCGGTGGCAGCGCGTTTCTCGGTGCAGCGACAAGCAGGCGGCTTCGCTCAGACCCTCGGTTCAAGCAGCCC
GACGGGTTCCATGGATGCCCACACCAAACAACAGTAGCGGGTATCTTGGTATGAGGTGTTGCTGACGAGCTCTCGTACAATAAATCAGTGGTGTGTGTAT
TATTTCTCTCGTCAATTCATCTGACCACCCTCCCAGTTAATAATCCATGTGCTCTTCCTCTTCGTCGTCGTCTCCTTTTTTGTATCGATGCGCCCGCTGT
CGCCGCCCTAGGTGAAGTTGCGCGCCATAATGTCGTCTCCGTGCGAGACCACCAGTCTGTCGTAGGCCTTGGCCGCGTCCGTGGGCGTCCAGAAGTCGCC
GCCCACGATCACGCGGCCGCCCACCTCGAGTTCGGCGCTGTACTTCTTGATCTTGGCGGCGTTGAAGCGCACGCCCAGGAACTCGTTGGCCGCCTCGTTC
TCCGTCTCGGCCACATGCACGTCCTCCACGTTGCAGCTCTTGGTGATGGCGCGCAGTGCCGACGTCTGCAGCGGACGCGCGAGAGCGACACCGTTGACGG
CCATCTGCCGAGCCGCTTGTCGGCCGAGCGGCACTTGGCTCTGTAGTCGAAGCACGCGGTGCAGAAGCTGGGGGTGCATGTCAGCTGTAGCGGGGCTACA
CATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTG
GTAGAAAGTAACACCTTTCTACCAACGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAG
GAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATA
CTGAACTTAAGTAAATTACTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTC
CAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACG
CATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGT
TGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGC
CACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATT
ACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAG
ATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGA
TCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTC
GTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAG
AAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTGTAATGGGGCCACGCTG
GCCTACACCGTTGCCGAGCAAAAGAACTTGTGAAAGGGGGAGACCCATTGTTCTTCGGTGTGGTTCACACTGGTCACCTTAAGTACGAGTACGTACTTCA
CACGAATTGGTGTGTGGCACTCGGCAGCACGTTAAGTACGATGGTGTACATCACACTAGGCACGGAGTCGGACTTACCGTAGCGGATCAAATGGGGGCCA
CCCATTTGGAAGATCGTCAGTTTAGACAGGAGTTCAGTATGCAGATAGTTTACAGTAGTTAGAACCTTACAAGTGAGATTAATACAGACAGTTTAACTCT
AACCTGGAAGTTCGCAAGTCGTTTGGTACTCGGTACCCGGAAACGACTGGAAGGCAAGCTTACAACAGAGACGCCAGGCGTCTGTTGTGGTTAG