Description :
From Genome Similarity Track
Location :
contig_30:123337- 125728
Transcript NameFunction/comments
g6531.t1RAW38333.1 Arginine biosynthesis bifunctional protein [Phytophthora cactorum
g6532.t1hypothetical protein

Sequence
2391 bases(100 bases per row)
CAGTCCAGCGCCCCCGCATCCACTCGCAACTGAACAAGTTGTTTGCTCCAATCAAGTTCATGGCGATAATTCACACCTACTCTACGCCAGCTTACGAGCG
GTAGTCGGCATTGATGGCCACGTACTCGTGCGTAAGGTCAATGCCCAGTACTTGAGTCTCCTCTGAACCAACGCCAAGGTCAATCTCCATCTAGTCCAAC
AATGAGAACAGAACAACGTTTAGAATAAGCAACCCATCAGAATACGAAAAGCGCTTACCTCGACAAACTTTCCGTGTGGCGGGAAGTTGTGCGAGCTGGC
ATCGAGGCCGCCACGAGTGGGCTCGATCAGCATCGCATCGCGCATGTGCTCCACAAGCTTGGCCTCAATCTCGTCGTTGAGCACCATCTCACCGTTCTCG
AAGATAATAACGCCACCCATGTGAATCTTCATGCGACGTGTGATATCCACGTCCTTGTGGTGCAAGCCCATGTACTTCCCCACCGCCATGACCAAACGGC
CCACGTTCGGGTCATTGCCAGCGACGGCACACTTCAGGAGAGGCGAATTTACGACCGACTTGCCGACACCCTTCGCCATCTCCTTGGACAGAGCGCCACG
CACGCGCACCCGCATCACGTGGTGTGCACCCTCGCCGTTTCGCACAATATCCTCGCTGAGTCCCAGACACACCTCGTGCAGCGCCTTCTTGAACTCATCT
AGCTGGCTCATGTCGAAGGGGATTTGGTCCGAGGACACGAGAGTCACCGTGTCCGACGTGCTCTGGTCCGTGTCAATGCTGAGAGAGTTGTACGTGTCGC
CAACCACCTCCGTCAGCAGCTGACGCAGCACGTCACGAGGGATCGACAGATCTACATCAAAAGCCACAGAAAAGTCAGTACAAGTCGAACACGTTAATCC
TGAACAGCCAGGACGCACCGGTGAGGATGTAGGACAGCATCGTAGCCATGTTGGGCTCAATCATGCCAGCACCCTTGGCAATGCCGACGATGCGTCCGCC
GCACACGTCCATGGAGCGGATCTTCGGATACAAGTCTGTCAACAAGCAGCAAAACAATCAGTTAACAATCTACGAAACCTCTATAAAAACCAGCTAGTGC
TTACCTGTCGTCATGATTCCCTCGGCAGCAGGCAGCACCGAGTCGGACTGCAGGCTGTTGACGAGCTTGGGGAGGTTCTCCACCATGGCTTCCACGGGAA
TGCGCCATCCGATGACGCCCGTGGAGCAGGGCAGCACCTGAGCGCCGCCCTCCAGCCGCAGGTGCTTGGCCAGGCTCTCGCAGACCTCTTCGGCGTCTGC
AACGCCGCCGCCACTGGCGCACACGTTGGAGATCTTGTTGTTGACGAGGATGGCGCCCAGCGTGGGCTCGTGCAGCCGCTTGCGCCCCACGAGCACGGGC
GCCCCGGGGAAGGCGTTCTGCGTGAAGACGGCGGCGAAAAGCGACGTGGGTTGCACAGGCTTGATGAGCGTCAAGGTCATGGTGGCCGGCAGGTGGGGCG
CCTCTCGCGGGATGAAGTCCAGCTTGGTGGTGCCCACGGAGAAGCCCCAGGGCAGGCGGCTTTGGTGCGTCTGCAGGTAGTCGGTGTATTCGTGGCGCGA
TTCGAATACGAACGGGTGGCCGTGGGTGGACAGGCAGCGAGCCTGCAGCAGCGCGCGCGGACGCGAGAGCGATGACATGCGAAGGAGCGACATGGCGACG
AATGCACTCGGGGGGACGCCGCTTTTCGTCTTGTGGGCCAGTGAACCAAAGATCGCCAGATATTAGTCCAAGTACGTGGCCGATTGACGCAAAATTTGGC
CCCAACGTACCAAATCATATAATTTTGCTCCCATCGTCCAATATGATCGACGGAAACGAGTCGGAGGCCGGCTCGGACGCGCCGCCGCCACCTCCGCCGC
CTCCTCCTCCCCCGCAGTCGCGTCCTGCGCAGCCGCTCAAGCCCAAGAAGAAGAAGGACTTCCGAGAGATTCTAACGCTATTCCACGAGGAGGAACAGCC
GGACGCCACCACGACCAAACGCGTCTGGGCGGCGCTGTGGCAGACGACGCTGGCGGAAGCGCAGGACGAGCACAAGCGGCGGCGGCAGCAGGAGCAGCAC
GGACTTAAGCGCAAGAAAGGGGGCGAGCATGACCATACGCCAATGAGAGGAGCGCCAGGATCGCTCTCGAGACACGGCAGCATGGTCCAGGACCACCTCA
AACGAGCACGACAGGTGCAGATTCTATTGCTATGCTTTCCGGGATTTTTAAACGCGTTTTTCACGAATTGTTGTGTTTTTAGGGCTCTTCGGCGAGCACG
GACTCATCCGAGTCCATCAAGGCTGGGAGACTGGGCGGTAGGTTCCCCAAGAACGCCCCGAAGGGTCCAAACTCCTGCAGAAGTTTGGCGG