Description :
From Genome Similarity Track
Location :
contig_73:123336- 126530
Transcript NameFunction/comments
g12268.t1hypothetical protein
g12269.t1hypothetical protein

Sequence
3194 bases(100 bases per row)
ATTAAGCAAAACACAACACCGAGCGGCTGATCTCGTGTTGGCACACTGCCAGATAGTCTCCGCCCTCGGCCATCTCAAAGTCAAGGCCAGGGCCACAGCA
ACGTGACATTCATAATAATAAGGTGGGGTGTATTGTATTAACCTTTCAGTCCCCGAACTCTAATAAATCAATGGTGGTCTTGCTTGAGCACGTCCAAGAT
GCGCTCGTCCGAGACTCGCTGGAAAAGGTCATATCACTCATAACTGCGGTCATAGCGACCCCTGTTTAGCAATCCTCAAACGTGTTGAGCCAGAACTGCA
GTGCCCTACAGCTGGACGCGTGACAAGACCAAGCAGGAGTTTTTGCTGTCGAGCCTGCATTGCGTTGAAGTTGGCTACCAGTAGTCGGCGGTCGGTCTGC
GTTTTACGCGCAAAAACAAGTAACAGTGGTTCGTGAAGAACGTCACGACGGGGGGTGGGGGGTCATTGTCGGCGGTGCTGTCTTTTTGCTCGCCGTCCCT
GCATTCACCCTGCCGCTGTGGGGCTCTCGGCTTGGCACTTGCAGGCTTGTTGGCATCGTGCTCTGTTCGCTAACAGCATCGGAACATTAGACACCTCGGT
CGGCTGCTCGCCAGGTATTAAACGGTGCTCAAACTTTGAGCACCAGCGCCTCGATGCCGATATCAATCAACGCCCACTCAGCAACGAACAAAGACAACAG
ACACGGATACTGATCTTACCAATGAGGATATCATGACCACGGCACGGCAGCACAGTTTGTCAGGCTGGACCAGTTGCAGAGGACGAGAGGTATACAGAGC
AGCTCGATCGGTCGCGAGAGTTCCGAGTCACGCGGTGGCAGCGCGTTTCTCGGTGCAGCGACAAGCAGGCGGCTTCGCTCAGACCCTCGGTTCAAGCAGC
CCGACGGGTTCCATGGATGCCCACACCAAACAACAGTAGCGGGTATCTTGGTATGAGGTGTTGCTGACGAGCTCTCGTACAATAAATCAGTGGTGTGTGT
ATTATTTCTCTCGTCAATTCATCTGACCACCCTCCCAGTTAATAATCCATGTGCTCTTCCTCTTCGTCGTCGTCTCCTTTTTTGTATCGATGCGCCCGCT
GTCGCCGCCCTAGGTGAAGTTGCGCGCCATAATGTCGTCTCCGTGCGAGACCACCAGTCTGTCGTAGGCCTTGGCCGCGTCCGTGGGCGTCCAGAAGTCG
CCGCCCACGATCACGCGGCCGCCCACCTCGAGTTCGGCGCTGTACTTCTTGATCTTGGCGGCGTTGAAGCGCACGCCCAGGAACTCGTTGGCCGCCTCGT
TCTCCGTCTCGGCCACATGCACGTCCTCCACGTTGCAGCTCTTGGTGATGGCGCGCAGTGCCGACGTCTGCAGCGGACGCGCGAGAGCGACACCGTTGAC
GGCCATCTGCCGAGCCGCTTGTCGGCCGAGCGGCACTTGGCTCTGTAGTCGAAGCACGCGGTGCAGAAGCTGGGGGTGCATGTCAGCTGTAGCGGGGCTA
CACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGAC
TGGTAGAAAGTAACACCTTTCTACCAACGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTT
AGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTA
TACTGAACTTAAGTAAATTACTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCG
TCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAA
CGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGAT
GTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCG
GCCACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCA
TTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCAC
AGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTC
GATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGG
TCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCA
AGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTGTAATGGGGCCACGC
TGGCCTACACCGTTGCCGAGCAAAAGAACTTGTGAAAGGGGGAGACCCATTGTTCTTCGGTGTGGTTCACACTGGTCACCTTAAGTACGAGTACGTACTT
CACACGAATTGGTGTGTGGCACTCGGCAGCACGTTAAGTACGATGGTGTACATCACACTAGGCACGGAGTCGGACTTACCGTAGCGGATCAAATGGGGGC
CACCCATTTGGAAGATCGTCAGTTTAGACAGGAGTTCAGTATGCAGATAGTTTACAGTAGTTAGAACCTTACAAGTGAGATTAATACAGACAGTTTAACT
CTAACCTGGAAGTTCGCAAGTCGTTTGGTACTCGGTACCCGGAAACGACTGGAAGGCAAGCTTACAACAGAGACGCCAGGCGTCTGTTGTGGTT