Description :
From Genome Similarity Track
Location :
contig_30:123331- 125722
Transcript NameFunction/comments
g6237.t1RAW38333.1 Arginine biosynthesis bifunctional protein [Phytophthora cactorum
g6238.t1hypothetical protein

Sequence
2391 bases(100 bases per row)
CAGTCCAGCGCCCCCGCATCCACTCGCAACTGAACAAGTTGTTTGCTCCAATCAAGTTCATGGCGATAATTCACACCTACTCTACGCCAGCTTACGAGCG
GTAGTCGGCATTGATGGCCACGTACTCGTGCGTAAGGTCAATGCCCAGCACTTGAGTCTCCTCTGAACCAACGCCAAGGTCAATCTCCATCTAGTCCAAC
AATGAGAACAGAACAACGTTTAGAATAAGCAACCCATCAGAATACGAAAAGCGCTTACCTCGACAAACTTTCCGTGTGGCGGGAAGTTGTGCGAGCTGGC
ATCGAGGCCGCCACGAGTGGGCTCGATCAGCATCGCATCGCGCATGTGCTCCACAAGCTTGGCCTCAATCTCGTCGTTGAGCACCATCTCACCGTTCTCG
AAGATAATAACGCCACCCATGTGAATCTTCATGCGACGTGTGATATCCACGTCCTTGTGGTGCAAGCCCATGTACTTCCCCACCGCCATGACCAAACGGC
CCACGTTCGGGTCGTTGCCAGCGACGGCACACTTCAGGAGAGGCGAATTTACGACCGACTTGCCGACACCCTTCGCCATCTCCTTGGACAGAGCGCCACG
CACGCGCACCCGCATCACGTGGTGTGCACCCTCGCCGTTTCGCACAATATCCTCGCTGAGTCCCAGACACACCTCGTGCAGCGCCTTCTTGAACTCATCT
AGCTGGCTCATGTCGAAGGGGATTTGGTCCGAGGACACGAGAGTCACCGTGTCCGACGTGCTCTGGTCCGTGTCAATGCTGAGAGAGTTGTACGTGTCGC
CAACCACCTCCGTCAGCAGCTGACGCAGCACGTCACGCGGGATCGACAGATCTACATCAAAAGCCACAGAAAAGTCAGTACAAGTCGAACACGTTAATCC
TGAACAGCCAGGACGCACCGGTGAGGATGTAGGACAGCATCGTAGCCATGTTGGGCTCAATCATGCCAGCACCCTTGGCAATGCCGACGATGCGTCCGCC
GCACACGTCCATGGAGCGGATCTTCGGATACAAGTCTGTCAACAAGCAGCAAAACAATCAGTTAACAATCTACGAAACCTCTATAAAAACCAGCTAATGC
TTACCTGTCGTCATGATTCCCTCGGCAGCAGGCAGCACCGAGTCGGACTGCAGGCTGTTGACGAGCTTGGGGAGGTTCTCCACCATGGCTTCCACGGGAA
TGCGCCATCCGATGACGCCCGTGGAGCAGGGCAGCACCTGAGCGCCGCCCTCCAGCCGCAGGTGCTTGGCCAGGCTCTCGCAGACCTCTTCGGCGTCTGC
AACGCCGCCGCCACTGGCGCACACGTTGGAGATCTTGTTGTTGACGAGGATGGCGCCCAGCGTGGGCTCGTGCAGCCGCTTGCGCCCCACGAGCACGGGC
GCCCCGGGGAAGGCGTTCTGCGTGAAGACGGCGGCGAAAAGCGACGTGGGTTGCACAGGCTTGATGAGCGTCAAGGTCATGGTGGCCGGCAGGTGGGGCG
CCTCTCGCGGGATGAAGTCCAGCTTGGTGGTGCCCACGGAGAAGCCCCAGGGCAGGCGGCTTTGGTGCGTCTGCAGGTAGTCGGTGTATTCGTGGCGCGA
TTCGAATACGAACGGGTGGCCGTGGGTGGACAGGCAGCGAGCCTGCAGCAGCGCGCGCGGACGCGAGAGCGATGACATGCGAAGGAGCGACATGGCGACG
AATGCACTCGGGGGGACGCCGCTTTTCGTCTTGTGGGCCAGTGAACCAAAGATCGCCAGATATTAGTCCAAGTACGTGGCCGATTGACGCAAAATTTGGC
CCCAACGTACCAAATCATATAATTTTGCTCCCATCGTCCAATATGATCGACGGAAACGAGTCGGAGGCCGGCTCGGACGCGCCGCCGCCACCTCCGCCGC
CTCCTCCTCCCCCGCAGTCGCGTCCTGCGCAGCCGCTCAAGCCCAAGAAGAAGAAGGACTTCCGAGAGATTCTAACGCTATTCCACGAGGAGGAACAGCC
GGACGCCACCACGACCAAACGCGTCTGGGCGGCGCTGTGGCAGACGACGCTGGCGGAAGCGCAGGACGAGCACAAGCGGCGGCGGCAGCAGGAGCAGCAC
GGACTTAAGCGCAAGAAAGGGGGCGAGCATGACCATACGCCAATGAGAGGAGCGCCAGGATCGCTCTCGAGACACGGCAGCATGGTCCAGGACCACCTCA
AACGAGCACGACAGGTGCAGATTCTATTGCTAAGCTTTCCGGGATTTTTAAACGAGTTTTTCACGAATTTTTGTGTTTTTAGGGCTCTTCGGCGAGCACG
GACTCATCCGAGTCCATCAAGGCTGGGAGACTGGGCGGTAGGTTCCCCAAGAACGCCCCGAAGGGTCCAAACTCCTGCAGAAGTTTGGCGG