Description :
From Genome Similarity Track
Location :
Scaffold_140:12332- 17116
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_140-fgenesh-gene-0.6HECT E3 ubiquitin ligase

Sequence
4784 bases(100 bases per row)
TCGTCTCGTCAGAACCGGAGCTGGTCGCTTGGGTCAATGTCGTTCCAGCCAGTCATCTCCGTGTCCGCCAGGCGGAAGTCGCCGTCCATCTCGACGCAGT
TGTGCACGGCGTAGAGCAGTTGTCGGCTGCAGACCTCGTCGCTCGAGTAGCACGGCAGTTGCAGCGCGAAGAAGCACGTGTGCGACTTGGGCAGCTGTGA
GTCCATGTAGCCACTGCCAGCTGCTCCGCCAGTCTCTCCATTCGCGCCGCCGCTACCCGAAGACGAGGAAGCCACGGATTGGATCTTGAACTTCTGGTGG
AATTGTGCCGTGCCGGCGGGCAGCCGCGAGCGCGCCCACACGAACCGCAGAAAGCAGCGCTTGTCCTCCTCGTCCATAGCCGTGAGTACGCGCCAGAAGC
GCTGCACGAACTCGTCTTGGGGCGACACGTCCTCGTCGTACTCGGTGTTGGCCTTGAGCAGCTCCACGTCGACCTCGGCGACGCCGCACACGCGCTTCTC
GAGCTCACGCCACGTGAAGAGGCCCAGTGCGGCCACGGGCAAGATCGAGTTAATGCCCTGCTTGATGATGTTCATTACGTCGTTCACCTCGTCCATTCGC
GAGCGGAGCACGGCGTCCAAGTACGATTCGAGGTTGTCGAGCGTCACGATCTTCGTGGCGCCGCCCTCACAGAGTTCGATCACGTGGCCGTCCGATAGGA
ACGTCGTGAAGGTCAGGTCCATGGCTTCGAGCTCCTCTTCGAGCTCCTGGACGCGGTGATCCGCAACTCCTACAGCTGGGAGCTTCTGGTACTCGTTGAG
TACGCCCCGCAGTGTTTTCCAGAGCGTGTAGGCGACAAAGTCGACCTCTTTCAGGTTTTGCAGCGCTGCCTCCTCCATGTCGTCACCATCATCTTCGACC
TCGCCAGCGAGGTGCTTCCAGACAGAGATTGCCAGGTCAAGACGCACACACACGCGCGTGCGCAGACATGTGCCCAGCATTTGACCCAGGAAGAAGAACA
TCTCGCCATGCAGCTGGCATTTTTCTTCAGGATTCTCCTGCTTGAGGTCGGCGGCGGCGTTCGCGTCATCTCGCTGCTGCTTCTTGTTCCTGTGGTTGGC
TCCCGCCGAGGTCTTGTGGCGACTCTGGTTCACTTGCTCGTTCGCGGCTTCCATCGCCTGCGAAGGCTCACGCAGCAGCGCCGCGTTGATCACAAACTTC
TCCCGGTTCGCGCCGACGCCATTGCGCCAATTCGGACTCGGCAGTAGAAACGGCAGCAGGCACTCGGTCGGTGTCTCTTCAATCTTGGACTCTGCTGTCG
TGGCTGATTGTTCGCCACCTTGAGAGTGACTCCTTTCGTTACTGTCATCGCCTTCGTGCTCTGTGCGCAGCATCTGCAGCTCGGCGAAGAACTGCGAGAA
GAACTCTCGGTACGGGCCGCCATAGTCGTCTACGCCCTCGCCTTCAAACTTGACCTTGAAGCACCGCAGCTGGCCGTCGTCCATGGGGTGCGAGTACACC
ATGCGCAGTGTCCGTAGCGGCAGGAAGTGCAATTCCTCGAATGCCTGGCCAAAGAGCGAGAGGAAGAGGCTCTTTGTCGTGCCCGGGTGGCACTTCGCCG
TCGCCGCTTTTGGGCGATTGACCATCACCACCGGCAGGTCGTCCGGGTAATCGTAGTCGTCGTCGGCCTTCTTGGGCGCGTTGGCCGTCTTCTCCATGAG
CGCAGTGAAGAACTCGTTCTTGAGCGCGATGAAGAGGCTGCCGCGGCACTTGGAGACCAGTTTGCAGGGCAGGAGGCTCATCTCGGGCGCAAAGTAGTGC
CACGTGAGGTCGAAGTAGGCGATCACGCGGCTAAAGTACGCGTTGAAGAAGCGCAGAAAGCCCACGCGGCTCACGATCTTGGCCTCGAAGCCTGGGGTTT
TGCCTATCGACAGCGATGAGTGGTGGAAACCCGCTCGTGTGAGCAAAGGCTCGAGCTCGCTTTCCTTTTGCTTGATAATGTCGAACGCGTCGGCGGGGGC
GACGTTCCACGGACTCACGCTCGAGGTCTCGCAGTAATCGTTCAGGATGCTCAAAATCTCGCGGTCGATAGCCAGAGTCCAGCGCGGATCGTTCACGAAG
CTCTGGAATTCGATGAAGGATAGCGAGTGTGTCGCTGAGGCAGCCGATGTGGATGACTCGTTGCTTGATTCAAATGGACTGGGGCTTGGAATGCTGTTAG
CAGCTGACGAAGTCGGCCTCTCTTGGCTGGTCGCCAGAGCCTGTGCGGCTTTTGAAGAGCCACTGGTATTGACGCTGATGAGCGTGAGCGACCGCAGTTT
GGACGGATGGAAGTACCACGCGCCTTGCTCGCCGTCCACTTCCACCCACAGTCGCTGCTCGGCGACACCCATGACCACGCCATTCCCCCGACAGGTTCGC
ACCCGCTCACCAGACTGGAAGCCAAATACTGCGCACTTGTCACGCGTGATGTCGACCCACAGAGGCTTCTCCGCTCGCGTCGTGACGTATTTCTTGGAGC
CAGCGATCCACTGCGTCGTCATCTCGTACGCAGCTCGCAGTAGCTCTTCGCGGACATCTGTCTTGTTGATCATGCAGACCATGAGCTCACAGACGATGAG
CGCTTCTCCAACACTACCAGGCGTCCGCTCTTCGCTCTCGCTAGGCTCATGGTCTTCTTGTATATATTCCGCCTTCGCAACGAGGCTCTCCGGTACAAAC
GAGACACGCTGGTGACGAGAGTAGAACGCCACTGCTGGACACACTTCGCCGACAATGTTGTCGAACGCAATCCCCAGATCCACGCCGTTCTTGGTGAACG
CCAGCGTCCCCTTCTCACAGTCGAGCGTCACGCCAACGCAGTCGCCTTCGCCAAAGTTCTCCCCATAGGCCTTGACTCGATTCCGCTGGTAGTACAGCGC
TTTGTCGCCAATGTAGCCCCACGAATGGTCGTCCGCGCCGAGAAACGAATCGCTACTCGCTCGCTGGGTACCCACTCCGACGAAGAGGTACGACGAACCA
GACTTCTCGATGCGCACCTGCCACGACACTACGCCAGTCGAGAAGCTCTCGGTTGCAAACACGGTCTTCCAGACTTCGTTGCCTGAGTATGCGACGCTCT
CTCCGCCTTCCGAGATTGTCAGCAGGTTGCTACGGCATCGTTTGCGGTCGAACGTGAGTGACCGAGGCTGTCCAATTGATGTGGACACTCTACCCAAGTG
GGACGAGAGCGAGGAGAATGGAGATCCAGAGAGTGCACAGATTCCAGGCTTCGAGTCGGCATGACCCGTTAGCTCCAGGAGCACGTGGAGAATCTCGATG
TATGCCTGGAGGTAGACGGAGAATACCAGCCGGTGCTGCATCACCTCGCGCGCGTGACGCTGCCCGGCTGCATACAAGAAATCGCCAATTTCCAGCTTGC
TCTCAACGAGGATACTGCCATCGTTGTCTCTCGTCTTATAGACTTTCTGTAGGATGACGCTGATCATGTGAAGTACCAGGAACTTGAGTGGTAGGTTTGC
AGACTTGAGACTGAATCGGAGGCGCTTGAGGAGCTGAGCGATAATTTGTGATGGCCTCCAACGCTTCCCAGTGCTCTCCTTCAGCACCACGTCGACGATC
CAGGAGACGAGTTCGATCGCTGGCTCGTCGTTGACAGTCTTGTCGGCTCGCGTGAGCTCCCGTTGGGTCCAGAGGTGGGCGTCGAAGGTTTTGTTGGACA
CTGCTTTCTCGATTTCAGCCACGCTGAAGTCGAGAATCGCGAGCACGAACGTGTCAAAGTCGTGATTTAGAAAGTATGCGATCGCTAGCGAGAGCGCGTG
TTCGGGGGTTCGCTCCTGTAGCGCGCAAGTCCCATCGTTGCTTTGAATGACGATGTTGAACTGGTTCCCGCGGAGTAGAACCATTTTCACGAGCTGGAAG
AACTGAGGGTAGGCCATTTGGTACAGTAGTGTTGCTGTATTGTGACCACCGAGATGGCTCATGTGGTAGCACAGCGCCACCATGCATTGCCGCGCGTACA
AGACCGACAGAGTGTGCTCGAGGTCCTGGAGGGTGGTCACCAACAGTTTGAGGTCCATTTGGCTGATGAGACTGCGATATTGGACGAGCTCCTGCGCATT
GTCGCGGAACAAGGCGCTGGGATCCGATGTCTCGAGTGGATTTTGCGTCTTTGCTACCGACAGTAGCTTCATCTCCACTGCAGCTCCGCGCCAGGAGTGC
ATGAAGCAGTGTCTCGTGTTGGAGCGATACCCGCTGTCTTCAAAAGGGAAATACATCTCGCCAAACACTTTGCGAGCCATCTCCTTGTCGTTTAGCGGCG
GGACGGTACAGACCGCACTGGGTTTCGACAATTCGGTAGGCTTGGTGTCTGTATCGCTCTCTGCTGATTGATCTCCGTCTAGCCCAGTGATTCGTGCTGA
TGTATCTCCAAACTCGGATCCATTGGCTTCATCACCATCAGCAACATTGTCGTCCTCTTCTTCGTTGAACCTTGGCGTCTCACGCCCTCGATCTCGCTGC
TTGTCGAGCGAGGTCTGCAGACGGCTCAGATACTCTAGGTTGTCCACAATCCACGCGGATGCGCAGACAATGTCGTTCTCGGTTTGCTTGAGCGCCAGGA
CGCACCATTCCTCTGGGAAGCCCATGAGCATGAGCTCCTCGACAAACTCGGCACGGTTCTCCTCCGCGTCCTCGTCTTCCTCTTCATCCTCGTCGTTGTC
GTCGCCCTCTTCTTCCTCATCTTCATCGTCGTCCTCCAATTCTTCGTCGTCATTCTCTTCGTGTTCGTTCGCATCGTCGTCATC