Description :
From Genome Similarity Track
Location :
scaffold_544:12332- 13445
Transcript NameFunction/comments
g9125.t1 hypothetical cleavage-induced protein

Sequence
1113 bases(100 bases per row)
TCGCGCAGTGAGCAGTCGGACCAGTGGCGCGGAGACCGCGGCGGACACGGCGGCGGTGACCGCTTTGGCCGCAGCGAGGAGGGCGGTGGCAACTGGCGCG
GCGGCGGCGGCGACCGCTTCGGCGGCCCCTCGCGCTACGACCGTCCGTCGCGCGACGACTTCCAGTCCGAGGAACGCCCGGCGCACATGCGTCTGAACTT
GGCGCGTCGCGGGGAGGGCTCGGGCGGCAGCGGCGACGCGCGCAACGGCAGTAGCGACAAGTGGTCGAGCGCGTTCGGTGGCAGTGGAAGACGCGAAGAC
CGCGGCGGCGACCGGTTCGGCCGTGATGACCGCGGCGGTGACCGGTTTGGCCGTGAGGACCGCTTCGGCCGGGACGACCGGTTTGAAGGCCGTGCCGCCG
GCCGATTCGCCCGTGGTGACGATCTGTCGTCGGGCATGTCGAACCTGCGCGTGGGCGGACGTCAGGAGCAGGCGTCGGCTGAGCCTGAAGTTACGGACAA
GAAGGCGCGCGCGCAGCAGAAGCGCGAGGAGCGCAAGAAGAAGGCGGAGGAGGAGCGTCTGGCCGCTGAGGAGGCTAAGCGTGTCGCTGCTGAGGAGAAG
AAGAAGGCGGAGGAGGTTGCGGCCAAGAAGGCCGACGTCGACCGGGAGACCATGAAGCAGGTGCTGGCCAGCGGCAAGAAGGGCGAGGAGCTGGCGGCTG
TGGCCAAGGACACCTTCAAGAAGAACGGCCGTCCCACCGGCGCCGTGGTCTTCGAAGCCGTGTTGAACGCGGCCGAGGACGTGGCCAAGTCCAGTGCCAA
CTGGATCGCCATGCCCGCGTACGGTGAGCTGCTCAAGTTCGCCATGGAGGACTCGGACAAGAAGGACCAGATGGAGGCGCTGTACGCTCTTCAGGTGTTC
CTGAACAAGTACGACTTCCCCAAGGGTTTGATCGAGAAGTGCTTCATGGCCCTGTACAGTCTTGACATCATTGACGAGTCTGGTTTCTTCGAGTACAAGT
ACGACGTGGACGGAGAAGTGCCCGGCCGCATGAAGGCTATTATCCAGACATCGACGTGGCTCACGTGGCTCGAGACGCCCGAGGAGGAGAGCGACGAGGA
GGACGAAGAATAG