Description :
From Genome Similarity Track
Location :
Scaffold_13:1233130- 1234500
Sequence
1370 bases(100 bases per row)
AGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTC
AGAGTTGCTGAACCTTGAGGAGCTCGCTATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACG
TCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACC
CCCGGGACCCGGTGTACCCCTTGGTGAAGGCGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGAT
CGATCTCGTGCTGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAA
GCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGC
TGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGTCGGCTGCACGCTGTATAGCGCGCTGGACCTGGT
GGACGAATACTACCAGATCCTGATGCGCGAGAGGGACATCCCATTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAG
GGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCC
ACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGATGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACAT
CGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCTGGGCGGACCCGGAGAAGGTGAAAACCATCGCG
GCTTGGCCGCCACCTCGGTCACAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGC
CCTTGTCGGATCTCCTGAAGAACGATGTCGACTGGCGCTGGGAGCGTCGCCATCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGC
CAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTTAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGG