Description :
From Genome Similarity Track
Location :
Scaffold_1495:1233- 3793
Sequence
2560 bases(100 bases per row)
ACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGCGCAACCCGTTCA
GGTAAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCATTGTTGAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCA
GATACTGCAGAGCGTGTCTTCGAGCACGCGATTGACGCGCTCCGTCTGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGA
AGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCGATCAGAAACAATGGTCTCGGGCAAACCGTGGTGTCGGAAGACACAGTCCATGA
ACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGGAGCAATGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCC
ACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGCCCGCTGGGACCAGCAGGCTCTGCAATGGTGCCGAGGCGTGACCG
GCAGGCTTCACGCGCTGGTACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTGCG
TCTTCTCACGGCCGAGATGGCCACTGGATGGAGCGTCGAGCGCCTCCATCAGGATGTCGTACTTGAGATCCTAGTCGTTGGGCACGACAATACGGGTAGG
ATCCTCGGGCTCGACCCTATAGTGGAGCAAACCGTCAACCCACTCATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGCTTCG
GAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGAGACTGGCATCGTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATAT
GAGCAAGCTCGTAGTCGGGTCGGCGCGACAGCGCGTCGGCAAGCACGTTCAACTTGCCCGGCTTGTACTCGACACGGAAGTTGTATTCCGCGAAGAATGA
CAGCCAACGCGCCATCCGCTGTGAGAGATGCGGTGTGTTGACGGCAGTCCGCAAGGACGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCCCAGGAGG
TGCACTCGGAACTTGACAAGAGCGTACTTCATGGCAAGTAGCTCCTTGTCGTGGACTGGACAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACG
AGATGACCCGTTCGCGGCCTTCATCGTCGGCCTGCAATAGCGCACAGCCAATTGCGTAGTTAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTC
CGGCAATGCCAGGACTGGCGCGCGCTGTAAGCTCGCTTTGATGTCGTTAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGG
AGATCCGACAAGGGCCGTGCCAGCTCGGCGTAGCCTGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAG
GTGGCGGCCAAGCCGCGATGGTTTTCACCTTCTCCGGGTCCGCCCGGACCCCGGCGCTGC