Description :
From Genome Similarity Track
Location :
Scaffold_243:1233- 2449
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_243-fgenesh-gene-0.1Gene of unknown function

Sequence
1216 bases(100 bases per row)
ATGCGTCAGGGTCAAGGTACTGACCTTCCTTCCACAGAAATGCCGGGCGCTCCGAAGCACAACGACGGCAAGGAATCAACAGCAGGTACGCCGCGTGATG
GAGTCCCAGCAGATCAGAAGACGGATCCAAGCCACCTCCCTGTCGACGATGACCTCCACGACGACAATGATCATCATGGAGCAGATGATGCAGTTGAGAT
CGAGAAGGAAGTGCAGAAAGCAGCAGCAGCAGCAATGGTTGCAGACAACGACGAATTCGATCCAGCACTGATGGAAGATCGCATGGAAGACTCCGTGGTT
GTTGTCGAAAGCCAGGAGAATACCCCACCTGAGGACGTCCGCACCAAAAAGGCTGTGAGTGACCTCCAGCCGCAACAGCCTCCAGCCGCAGTTGTGCTGT
CATCCCCTGGTGGTGTGCTTGAGCTAATGTCGACTCCAGTCGTCATTGTGCCCTCTGCTGTCGTCCCAACTGCTGCTGCGGCTGCTATCCCTACCACTCT
TCTTCCGAAGCAAACCCCAGCGGCGACGACTTCCGAGACAGCGCTGAAGAGCGAGAACGTGATCAATGGTGCGTCTCCACCTCCAAAAAGCAAAGATGAG
ATCGCTACGCACGAAGAAGAAGAAGATGGAAGAGTAGTAGTTGACGAAGAGGAGGAACATGTGTCATCAACTCCACCGAAAGAGGAGGAAGTTACGCAGC
AGCAGCAGGAAGCAGAAACGATGGAGGAGCCTCACCGTCATCCCGGCCGCGATGAAACGTGACGCGTTCCAAATCATTAGATGCAATGTGTGCTGCTGGC
GTGGTAGCAACGTAGCGATCGTAACAGAATGCACCACCGACTGTGAGTCCTGCACGACTGCAACGACGAAAGTCACGCACGACATGCGATTGTACGTGGG
CCAATGTAAGCAGCACGTTATTTTTAGGTCACCTGTCCTAAAACTGCACCTCCTGGCACGAGAAGAATTTCTGAAGCGTTCAGATGGAGTCGCTTTTCGT
TCAGAGATAAGTAAATATAATTTCTCACAGGTAATTATCCATATTTTCTTTCACAAACCACGCGATCATATAAGAAAGAGAATTCTTAATAGAAGGTTCA
CAGACGGCCACTATTCGAAGCAAATACTCGAATCGGACTGAACCGATAGGAAATGGGAGTGCTCAATGCAGAAAAAGAAGACGAGGCTTTGCCAGTCGCG
TTCCCACTGCAGAGCT