Description :
From Genome Similarity Track
Location :
Scaffold_93:12329- 13976
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18838myosin-like protein

Sequence
1647 bases(100 bases per row)
AACCAGTCAATCCTGGTCAGTGGTGAAAGTGGCGCTGGTAAGACTGAAACCACGAAGTTCGTGATGAACTATTTGGCCACCATTTCGCAGCACAAGAACG
CCTCAGCCGACAGCAACGTCATGAAACAGGTTTTGTCGTCCAACCCGATTCTCGAGTCTTTTGGTAACGCGCGAACGATCCGCAACGACAACAGTAGTCG
TTTCGGTAAGTTCATCAAGATGGAGTTCTCGTCGGAGGGAAGTCTTATCGGAGCGTCGATTCAGACGTATTTGCTGGAAAAGGTGCGTCTCGCGTACCAG
GCCGAGTCGGAGCGTAGCTACCACATTTTCTACGAAATTATTGCTGGAGCCACCGCGGAGGAAAAGAAGCGATGGAATCTCAAGGCGCCGACCAAGTTCC
ACTATCTGAACCAGAGTACTTGCGTGAAGCGTAAGGATGGCGTGAACGATGCGGAGCAATTTGGTGTTTTGAAGAACGCCATGCAAACGATGGGATTTGA
TGAGGACGACATGGAGAGCATTTTCGTCACAATCTCGGCTTTGCTGCACATTGGTAACTTGGAATTCGATGAGACACACCATGCCTCAGGTACGGAGGGA
TCTGAAATCTCCAACATGTGCGAAGATTCGATGAAGGTGGTACTGGACTTCCTGGAGGTAGACAAGGATGGTCTTGAACAGGCAATTTGCAACCGCAACA
TCCAGACCAAGGACGAGCACTACTCAATCGGGTTGCTGCCAGATGCAGCTGAGAACGCGCGTGATGCACTTGCGCGATTCCTGTATGGAAAGCTCTTCGA
CTGGCTCGTTAGTCGCATCAACGAAATCGTGGAGAATGACGACCGCGATGTCCCGTTCATCGGTCTATTGGATATCTTTGGTTTCGAGGACCTGGAGCAC
AACTCGTTCGAGCAGCTGTGCATTAACTTCGCGAATGAAACGCTACAGCAGCACTTTAATCGCACTGTTCTGCGTATGGAACAGGAAACGTACGAGAAGG
AGGAAATTCAGTGGAGCTTTATCAACTTCCCCGACAATGGTCCGTGCATCGACTTGATTCAAGGCAAGCCGTTTGGTATTCTTCCCGCTCTTGATGAGGA
ATGCATTGTTCCGCAGGGTAATGATCAGAACTTCGCACGAAAGTTGTACCGTCAGCACGAGCTGAACCCGCACTTTAGCGCTAGCAAGACGGAGATGGCC
AACCACCTCTTTGTCGTACACCACTACGCTGGCGCTGTCACTTATGACACGTTCGGATTCTGTGAGAAGAACAAGGACATTTTGTATCCGGAGATCACTG
CCATCATCAAGCGATCATCGAAGCCGTTCGTTCGTGGCCTTCTGCAGGTCTCGCCTGAAAAGAAGACACCGTCTAAGAAAACTAAGGGCCGCGCTTCCAG
TATTGCTACTCGCGTTAGTCTTGGTCTGCAGTTTCGTACTCAACTGAAGACTCTGCTGGAAACTATCAACGTCACTGATTGCCACTACGTGCGATGCTTG
AAGCCCAACGACAAGGCCAAGGCCAACTTGTTGGTGCCCAAGCGTGTATGCCTCCAATTGAAGGCTGGTGGTGTCCTGGAAGCCGTGCGTGTCAACCGTG
CCGGATACCCCGTCCGAATTGCTCATCAGCAGTTTATCAAACGTTAC