Description :
From Genome Similarity Track
Location :
Scaffold_30:123279- 162171
Transcript NameFunction/comments
Physo_134122ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase
Physo_156840hypothetical protein
Physo_116069putative endoplasmic reticulum oxidoreductin
Physo_134125hypothetical protein
Physo_134126putative aldehyde dehydrogenase
Physo_108753predicted protein
Physo_134128glutamine amidotransferase, class I
Physo_108754serine-tRNA ligase
Physo_156844predicted protein
Physo_156845hypothetical protein
Physo_134132hypothetical protein
Physo_156849phosphatidylinositol glycan, class N
Physo_156850hypothetical protein

Sequence
38892 bases(100 bases per row)
GTCGCTCGATGCCTGTCCCGATGAAGACTTACTGCCGCTACACATGCTTTTGGATCGTTCTGTATTTGTGTAAACTGACGTTCGATTACCAGTTTGTTGT
CAAAACGCTGGTGGAGACGACGTTGTTCGTATACTCAGCCAACTCGACCGACTACCTCAAGTACTCGCACTTCATGCTGCAGACCACGTACCACAACATC
ATCTATATCCTGTTCCTTTGGATTCCGGCGTGGATGGTGTTCCTGTACGACGCGCAGATCTTCTACTCCGTTCTGTCTGTTATTTACGGTTCGTTCGCTG
GTTTCAACCTGCGCATTGGTGAGCTCCGTTCGTTCCGCATTCTTCGCCTAACCTTCAAGAAGATTCCTGGCGTGTTTAACCGCAAGCTCGTGCCCAACAT
CGCCGAGGAGCAGGCCAAGAAGAAGAAGAAGAAAAACAAAAAGAACAAAAACGAAAGGGACGAGATGGCCATGCCGGTGCGCCGCTTCGAGCGTATTTCG
ATGTCTCAAGGTGCCAAGCCATTGACGGTGAAGACACAAAAGTACTCGAGTCTGCTTGAACAGCGCGACGACGAAGATGTTTACAGCGAGATGAAGACCC
CCAACGGTACGGACGAGGACATGTCGTCGCAGTCCAGTCGTACTTCGAACATTGGCTCCATCACTGGTGTGTCTGGAGCGGAGTTCGAGCGCACAATCCC
GTTTGCTATGGCCTGGAACCGTTGTCTGACTAGTCTTCGCGAAGCCGATGTCATCAGCGACCGCGAGCTTAACGTGCTGAGCTATTTGATTGATTCTAAG
GATACGGTGGGACGCAAACTGTACCCGCCGGCATTCTTGACGGCTGGCAAGTTGGACGAGTCGATTGATATTGTTCTTGAGTGCTCGGCGCTCTATGAGA
AGCTGAAGACCGACAAGAAGAAGAAGGACAAGACACTTCAGAAGATTGAAACCACGATGCGTGAGCGTCTGACCAAGGATGATCTCCGTGTCGAGTCCAT
TTTGGGCTCGTACAAGTTTTCATCGCAAGTTCTTCGTATCTTACTTGGTGAGGAACACAAGGAGCTGGACGACTGCTACAACTTCATCGAAGAGATGGCT
TCGCACCAGCAAATTCTGAAGGGTCTGAAGCTGGACAACCTGTACATGTGCCGTGCTGCCGCTGCTGAGTTGATGAAGTCCATTCTGGAGGTGCCTAAGA
AGTCGACGGAGACTAGCATCAAGTTCCAGCGTGCTCTCTACAAGGTCATTGACTCGGTTGAATCCGTGATCAACTGTCTCAAGATGGTCCTTGCGAAGCA
AGAAAACCTGGTTCAAATGCTGAACGACACGCCGCTGAAGCCGAACTCATTCTTCTTCCCTGGCGATGCTCAACATTACGCGAGTCTTCAGCTCCAGAAG
ATTGTGAACGACGAGGCCGCGTTGGACATCGTCTCGCGTGCGTACCAGCTGCTGACGGTGGATAACTTTGACGCGGAGCCGCGCTCGGACGAAGGACGGC
GTCGCCTGCGCTTCTTTGCCAACTCGCTCTTTATGGACATGCCTGAAGCAAAGCCGATTCGCAAGATCCGCTCACTGACGGTGTCGACTCCGTACTACAA
CGAAATCGTGATGTACTCGATCAAGGACTTGACTGCTCAGAATGACGACTGCATCAAGCTGCTGTACTATCTGCAGACAATCTATCCGTTCGAGTGGGAG
AACCTGCTGGAGCGCATTCAGGCGAAGGATATGAACGAGGCTTTAAAGAAGAACCCTGAGGAAGTCCAGCTGTGGGCTAGTTACCGTGGTCAAACGCTTG
CACGTACCGTTCGCGGTATGATGTACAACGAGGAGGCTATTCGTTTCTTGCACTGGTTGGAGATCGGCGAGAACGAGCCGATGCACCAAGTGACATGTTC
GTGCAACAAGTGCTGCAAGCTGAATGAGATGGTTGCGCTCAAGTTCAACTACGTGTGCACGTGCCAGATCTACGGAAAGCAGAAGGACGAGCAGAAGCAG
CAAGCTCAAGATATTGACTTCCTGTTGCGCAAGCACCCGAACCTTCGTGTCGCTTACGTGGACGGCCCTAAGAAGGTGAAGGATGGTCCTCCCAAGTTCT
TCTCAGTGTTGATTCGAGCTCAAGATGACAAAATTGTTGAGATCTACCGCGTGGAGCTACCGGGTAACCCGATCGTTGGTGAAGGTAAGCCCGAGAACCA
GAACCACGCTATCATTTTCTCTCGCGGCGAGCTGCTCCAGTGTATTGATATGAACCAAGATGGCTACCTCGAGGAAGCCTTGAAGATGCCGAACCTGTTG
TCGACGATGGACCGTGGCACTGAGAAACGTCCTCTGACAATTATTGGTTTCCGCGAGCACGTGTTTACGGGTGGCGTGTCGAACTTGGCCAGCTTCATGT
CGATTCAGGAGTTGTCGTTCGTGTCGCTCGGCCAGCGTATGCTTGCTCTTTTCCACGTTCGTCAGCACTACGGTCACCCCGATATCTTCGACAAGCTCTT
TGCCATGAGCTGCGGTGGTACTGCTAAGGCGTCCAAGGGCGTCAACCTTTCGGAAGATATTTTCGCTGGTTTCAACAGTACCCTTCGCGGTGGACGTACG
TCTCACGAGGAGTTCATCCAGGTGGGCAAGGGTCGTGATGTGGGTATGCAGCAGCTAGCTCTGTTCGAGGCCAAGCTGTCATCTGGTGCTGGTGAGGCCG
TTATTTCCCGTGACGCCATGCGCATGGCTTCTCGTCTGGACTTCTTCCGGCTGCACTCATGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGTCGAT
GACTGTGGTGGGTGTGTACTTCTTCATCTACGGCAAGGTGTACATGGCTCTGAGTGGCATGGACAGCTACTTCCTCGAGAAGGGTGGTCTGGGTATTGCC
GGCACGCTCAACACCTCGTGGGCATTCCAGTTCGGTTTCTTGTTGGTTGTCCCCGTCATTGCCGTGGTTGGTGTTGAGCAGGGTTTCCGTCATGGTTTTA
CCTATTTGCTGTGGAACATCATGACGCTAGGTCCGATCTTCTTTACGTTCCAGATGGGCACGCGTATGCACTACTTCGACCGCACGCTGATTCACGGTGG
CGCCAAGTACCGCGCTACGGGTCGTGGTTTCACGATCAAGCACGAAAAGTTTGCGGAGTTGTTCCGCTTCTACGCCTTCAGCCATTTCTACCGTGGAGTC
GAGTTGTTCTTCTTGTTGTTGATGTTCTACGCGTACGGCACGTTCTCGTGGTGCAACTGCTCGTGGAGACTGGATGCAGACTTTTACAACAATGTTGAGC
CCACTGATTTGGAGTGGCGGACTCGTTGCTACGCCGACCACTACCAATCCTGTGTGCTCCCGACCAACCAGAACTACGGTATGATGTCGTACTCGCTGTG
GATTATCGCGGCGACTTGGATGTGGGCCCCGTTCTTCTTCAACCCGAGTGGTCTGGACTGGGATAAAATCATCGAGGACTACAACGACTGGCAAAACTGG
CTGAAGACGACGAATGACTCGGCTGATAGTTGGTTTGGTTGGTGGTCGAACGAGCTGGAGTACCTGGAGCACACCACACGTGGAAGCCGTTTCATTTCGG
GTGTTCGCAAGCTTCGATTCTTGTTGATTGCTATCGGCATGTACCTGAACATGATGTACGACGCGTACTTCGAGACTCCCGGCCGGATCATTACGTCAGA
CGATGACATGCTGACTTACGCGCTGTCCGGTCTGGTCGTCGTGATTTTCTTGCTGCTGATCTGCTGTGGCTACATCGCAAGTCGTGTGACCAAGAAGATG
TCGATGAAGCAGCGCAAGCTTCGAAAGATGAAGTTTGTGCTTGCTTGCTGCTGCTTGCTCATCTCGTTCCTGAGTCTGACGGTACTGTCGGTTGCGAACC
TCTTCGAGATCTTCGTGCTGCTGTTCGTGGCAGTGTACTGGTTCATGCAGATGTGCATCCTGCGCCTCCAGTACCACCACATTGTCGTGCGGGCACTTGC
TCGTGCTTACGACCGTGCGGTCGGCTGGATCGTGTTTGGGCCCATTATGATCGTGTCGATGTTCCTGCCCTTTATCTCCTCCTTCCAGCAGCGTGTTATG
TTCAACAACGCCTTTACCTCGGGTCTTGAGGTATCGAAGCTCTTCGCACACGACGTGGCACCGGCACAGGTTGTCAAGGTCAAGCGCGTATCGAAGAAGA
AGAAAAACCGCGATGACTAAGCTAAGCGTCTTGCTGGCTCTCCTCTACTGAGTTGGTCAGCTAGTCATGCTATTTTGTATCTTCATAGAAAACAAGATAT
TGGTTTTCGTTTGTTCACCGATTTGCTTGCGCTCCATTCTTTACATGATTGGCAAGTGGTATTGACGAACTTTGCAGCAATTAGATAAGTTGTAGCGGGC
ATAGATCTCAAAACTACTGCTAACCCTGCATTCGAGTGAGATCCGGGGTAGACACAACGTGGCGCATGCCTGCAAGTTCAGCTGCAGAACGGTTGTTCAA
ACTGTTGTGCGGATTCACGGCATTCCGTTGACTGAATGGGACGAAGGTCCCCGAGGTGCTCACCGGTGCGCGAGCATTGTTGACACGAGGCGGAGAACCA
ATCTTCAGCTTGCCTAGGATCTCGGAAAACTTCTGAGAATCGGGCTGGAAGCGCTTGAGGTCTAGGTTCCGTCGGGAGTCTCCAGCAGCTTTTGGTTTTC
GTGGACCGGATCCATTTTCCTTGCATTTTAGCTCAAAGGAGGATCGCGAACGCACGGAAGGCATCGTCAACTCGTGCGAGGGGGAAGAGGTATCACTGCT
TTGGTCATCTCCTGAAAGCGGCTCGGATTCACTCTCGATAGATGACATTGTGTTGCTTCGACGGCGTGCTCCAGCCTCGTCGTCTTCATTCGACTGACGC
GAGCTTCGACTGCTCAAGTCGCTCTTTGGAGCAGCGCCCACGCTGGATGTACCCACAGGACCAATGCCATTCGAGCCAGCCGTGACTTCTCGCATCCTCA
TCACGTCAAACTCATCGGCGTCGACTTCATTGTCGATCTCAATTGCCATCGCGCTCTCCGTATTTCCTCGAGACATTTGGTGGGCAAGGCTCTGGATAGC
GTCTTCGATCGCGTGCATCCACTGCTCCTGACGACCCCAGGTGTCCGTGAGCACGATAAAGTTCTTGTAGCCCTTTGACGAGAATTGAAGGCCGTGAGCA
CCACTGCCTGGGCCCTCCGTCACGCCAAAGCTGTACCACTTTCGGACTGATGTTGGAATAACCCACTTCATACGGTTCGCCCAGTTAGCGCTTTGAAGTG
TGTCGCAGTACCACAACTTATCGCACACTTGGCACAGTCCGAAAAACGTGATCGTGAATGTGAGAGCGTGGAACGGCATGGGTACCGGGAACTGGATAAA
CGAGCTCACTCGCGTAGGCTCTGGAATAGGGATATGATCATGGATCTTGTCCTTCTTGTACATGAAACCAGTGATGAACTCGTCTGTATAGGTGACCTTG
CAGTAGTGGCTCGCAGCTCCAGAGAAAATGGTCTCCAAGTACCCTGTGTACTCGTCCACGTCGGCGTTCGTGAGTGTGGCGGCCACGTATTCGACTGCGC
TCTGCTTAAGCTTCAAGCACCCATGGCACAGGGGGGCGTTCCGTTCACCAAGTGGTAGCATCTCGACACGGTTCTGCTCAGCAAGGGTTTGCTCGAACTC
CACCCACTTCTTGTGTTGCGAGGTGTATTGCCGTACCACATCCTGGGAGGTGATCGCTACCGAACCACTCTTGCAATTCGGAGTGCTGTAGTAAGCAATT
ATCATTTCACAAGTTAGTGTAAAAATCCCCAGCAAACAAGCAAAGCCATTAAATAACAACGTACTTGGTCAGCGTGAAAATACTGTTTGCGATGGTTGTC
ATGTGACCCTTGTACTGCACGTGCTCTTGATACGCGCGGATGACGAAATCCAGGATGTTCGCCCCTTCAATGAAGAGGCTGTTCAACAACGGAGACGACG
GCAGCCGTTTTTGATCCGGATCCATCAACACAAACCGAATGACGTCCGTAAGCTCGTGGTGCAACATGCTATTGCTAGGATGCGACCCGTAGCATGCAAG
CAAGCATGGCATCAAACCAAAATTCGCCATCAGGTAGTCGACGTCTCCACTCTGTAGAAGGACACACCGCTTAAGGAACGTGATGATATGCAGAAGCGCA
GACCCCTTGGTGTTAACAGCCTTGATACTCCCTGGATTATAAGAGGTAGACATCGCACGAAGTGCATTGACGTCCGACGTAACAACTGCGCGACACAGCT
GCACGAACTTCTCCACTCGCGGAATCAAAGCGGTTAGCACAGACACGTAGACTGTCTTCAAGAGCCCTTCAATCCCCGTTACATCACGTTTCTTCTTGTG
GTAGCCCAGTGTACCCATCAGCATCATAACGATGGACAAAGAGCCACCCTCACGAACAACCAGAGACGTGCATCCTTGGGTGCACTGACGACAAACTTCA
GCGAATCCCAAATCGATAAGCGTTCCAAACGAAACATCCGTTGTGTTGAGTAGGAAAAGCAACAGCGACTTGAACAGTTCGTTGTGGTGAAGTGGGAAGT
GCTGGTCTGTAATTAGCGGCAACGAGTGGTCTGTGTTCTCCACGAAAGTCGCCACGTTGTTCATGATGTACACCGAAGGAGGATAAATGATGTAGTTAAT
CAACGAGCAAATATTTTCGACCGAGTCTCGCTGGAAAGCTGTCCCCACACCCCAGCCTAGAGTCCGCTGCCACGAATACAGGCGAGCAAACAAGCAATCA
AATATGCCGCTCTTCTGCACATTCAGTTGACCGGACTCCGACATGTCCGAGTACAGCAGCCAAACAACCGTGTCGCGAATTGAATCCAGCCCAATGTGGC
AAACCAACCAAGGTACGATAAACTTTCCTTCGTCTGCTAGGAAGCGCCAGATGAGCTCTCCAAGATTCTGGTTCACAATGAAGTGATTGACGACTTTGCA
AAATAGCACCAGCAGCACGTCGTCCAATGGATCAGCAGTACACACGAAGTTGAATAGTACCTTCAGGTACCCGGACGAAACCTTGATGTCATACGCATCC
GACGCGTTTAAAGTCCATCCTGCGCCACCAGGCTTGTAGCCTTTCTGGAATATCTTTGGCGAGTACGATAGTGCCACCTCGCTACAGAAATGCTGGACGG
TGTACTTGCCGTAATTAGGATCCTCCGCAGGGTCGGACTCGGGGGAAGTGACCGGAACCGTGAGCAGGCGAAACACTTCATAAATAATTCGAGGTTGCTC
CAGCCAGATGCTGGACTTGTGCTCACGCACCATCTCTCGGTACAAAATGTCCACTGACATTTGACTGCTCTTCGCAATTTCGAGCAGCTCACGCAACGTC
GAGTTCGGTTTGGCAACCGTTTCCTCGATTTTGCGACGATGATCCTTAACGGATTCCTGACAAAATAAATAGACGAAGTCAGAAACCCATTTTCAACACA
CGTACAAACTACGATATAGACTAGCTCTGCATCACTCACACTTTCCGCTTGCTCACGTAAAAAATCTTCAATGTCAGCATGCCCTGCCATCCGCGCCAGA
TGCTCTGCTGTGTTGCCATCCCGCTGCAAGACGATGTATCAACATTAACTTTAGTAAGTACCAGAGCCGACGCAACCATACCATGGTTCTCATGTATACG
TATCCACTTACATCCTTCGCAATCAAACTAGCCCCGGCGTCAACGAGGACCTTCACACAACCCAGATTTCCGGCGCGCGCGGCTTCCATCAAAGCTGTTG
TTGAGTTCGGCTACGCAGAAAAAGATTTACATGCGTTAAAATTCCATAAACACATCGTTCTGACACATTGATCTACGTACACTTTGAGTCTCAAGCTCGG
CTCCTCCTTGCAACAAAATGGAGCAGCATTCCTCTTGGCCACCTCGAGCTGCAATGTGAAGCGCTGTAGTTCCGCGACTCTGACATAGTTTAGCAATCAC
GGAAGCGATCAGTATGGAGACACTTTGCTGGAAACGAAAATGAGCCGAGTTCTCCGTACTCTGTTTCTGGACAGGTTGATTCTTGCCCCCTTCTTGACAA
GAAGCCTCACGCAAGAAGCACGTCCATCACGAGCAGCGACCATCAACGCGGTCATGCCGTGCACCTGGAAGTCGTTGTACATTAGTGTCAGATCTCGCCC
AACTAATGCGGTATAAACGGAAATACTTACGTCTTCCAAGTCGAGACTAGCACCAAACATCAGCAAAGCGCGAGCGGCTTCTACATTTCCAACAGAGCAC
GCCATCATAAGCGGCGAAACTCCTGTCGGCTATTCGGGACAAACAAAAACCAAAGTTAAATCCTCTTCAAGTCACGAACAGCATCATTGCCCTGCAAACC
ACAACAGCCATTACCTTCTGCTCATCTAGAGATACTCCTAAGCTGTGCAGAATCTCAATGCAGTCCACATGTCCGTTCTCCGCGGCATCACACAGCGCCA
CAGCCTTTGGAATGTTCTGCACAGGCACCACAAACAGGCCCCCAGTCAGCAATCCACACCAATTGGAATAATACTGCAACTACAGACGAATTCAGCACTG
ACATCCACCACATTTCCTGTCGTGTCAATCTCAAGCAAGTGCCTCAACAGCTCCACATCTCCAGCCCGCGCCGCAGTCTGCACTCCAAAGTACACGTCGT
CCGGCACTACATGCCTGCAAGCCTGTTCTCTCCAGAGCAGCTCGATCGAGATCCGCGGCGGTTTGTCCGCCAGTAGCTGGTCCGCGTGGTACTTGGACAG
CAGCACGATCGGGATGGACACGGGCTGGCGTCCGGACGAGTGGAAGCCGTCGAACAGCGACTGGATCGCGTGCTTGTTGTCCGTCCGCTCGATGAAGACG
ATGCCCGTGACGCCCGCCGCCAGCAGACGCCGCACGATGTCGGGGAAGTGGACGCGGCCGCCGCGCTCGACCACAGCGATGTTGCCCAGCAGCGCCGCCT
TGTTCGCCAGCTCGCCATCGGCCTTGGGCGGGTTCGTGAACACGACGGTGCCCGTCACCACGCGCGGCACGCGGTCGTAGCGGTAGCTCGAGGGCTCCGC
GAAGTGGAAGGTCGTGGCGGTGGCGGGCGCGCTGTTCTGCGCGTGCAGGTTGGCGTCGATGTCCTGCGCGGGCGACACCGGCGGCTGCTTGGGGCTGCGC
TGCCAGCTCACGAAGGGCACGCCGTCGCAGCGGGACCCGCCGGCCGTCGACTGCTCGTTGCCCATGCTACTAGCGACAGCGAGTGCGGAATGTCCGGAGG
TTGAAGGGCAACCCCGAAACCTCGAGCAGGAGTGATGGTCTTGTCAGTCAGCCGATGGATCTCTTCGTGTCGCCCGTGGCAAGGCGAAGACGCGGCCGAG
TCACTCGCCCCACTTGCTCGCCTGGACGCGGAGGGAGCGGGGTGAGGGCGGCGGCGCGTGGGGGAGTGGGCTGGGGTTTCCTGGCGCGGGTTGGTTGCCC
CAGTTCTTTTTTTTAGCTCGAGCGCGCGCGAGCGAGCAGGGCTGCGATGCTTTGAAGCCACCAGAGCAGTTGAAGGCGAGTGACTTGAGTTTGTATCAGG
GCCCGGTCCGTCCAATCGCCAGCCGTTTCCGAACTGGGAAAAAGGGATCAGAACGTTGCCGGACTCAGGGTCCGCTTTGCTTGTCGGCTTGCTTTGCAGT
GCCAACACCGGCGTGCCCACGTCCATTCAACAATGCTTGCTCAGCATGGCTTGCTGTGAAAGCATCGGTTTGAGCAATTACACACATGGCGGTTGAGCTG
TCGAGACTCGAAAAGCAGCTTCTCTTGCTTAACTCGAAAGTAGCTGCTTTTCGCGTAGACGAAGACCAAGGTGAACATACCAACTCACAGCTGAATACGA
AGTAAACGAGCTCACCATGAATTCGTAGAGCACTCGGCACTTTGTAGTCGATAGCCCATCTTGGGTTTCATCTTGGCAGCCAACGTCTGCGACTTGAGAA
AGGGTTCGCGGCCCAATAATCGGGCATCCCTTTCCGCATGGAGTCCCCCAAATTCCGGTCATCCACAACGAGATTTGCAAGGTGGAGATGGCAGGCCGCG
CCGTTAGCGCCGCGCAAGTGCAGCAGCGGCTGACGAAGAGCTGGTCCACGCTGCGCTATCGCATGGAGTATGGCGGCTACCTGTCCAACCACCTGCTGCA
CGGCGTCGTGGCGCTGTTCGACCTCGGCGCGAGCGAGGAGAAGATTGAGGACTTCGCGGAGAGCTACTCGACCAAGCTGGAGGAGGAGCAGCCCAACCAC
GAGGACGTGACGCAGCCTGGCGCTCGCTCGAAGCTTTTGCAAGACTCGAAGCTAACGCTCGAGAGCTCGCGGGCTTTGCTCGGCAAGCGTGACAACTTCG
ACGGACTCTTGGCGCTGTACGCCGCGGAGGTGGAAGAACTGGGCATCGACGGAGCAGTGAAGAAACACTTGCCGGGTCTTGTCGGCGGGCTTGCTGGTGC
GCTCCTCCACTCGATCATCCAGCTTGGGTATGCCTACCACGTCGGTGGTGGCCGTCTCGTGGCGGAAGGACTGGCGTATATGCACTATGCGTACCTTTCG
TTCGACGAGCCGGAGAAGCTCAATGGACAGGAGCTATCGGAGAAGAAAGCACTATCGCGGGAGGAGGCTCTGCGCTTGGTGCGCATGCTGAATGGTCATG
AAGTTCTGCTGGGCGAGATGCGCCGTAAGCTGCAGTCGAAGCCTTTGGCCGATCTACAGGTCGGCGGCATCCAGAAGCGACTGAGCACCATGTCGGGTGA
CGAACGAGGGAGCGCTGTGGCTTTTAGGTTGATCTGGAAAGTGATCGACAGCTACGACCTGTCGAAGATGGACGGCGTGTTTGCGATCGACCTCGCGCTC
TGGCTGTACATGATGATCGAGCACAACGACTTCGTCATCCTCCACGCGGTGACATCGGCGTGGGCTCTGCAGCAGGTTGATCACCTGCTTGAGCCGAATG
ACCGCGAGCGCTCGTGGAAGGTGTGGCTCCACGTGTCGCTATCGGCGTTCGTCACTACCGAGATCAAGGACCTCCTACCGTCGGATGTGTGCGACCGACG
GCTGGATGAGTCGTCAGGCCTGGACCCCTGGAGCCGCATTGCTGCGAAGACGTTGGGTCTAGCTGATGGAGGGCTGCTGGAGCGCGACCTCGTGCACGCG
TACAAGCTGGTGCAAGTAGCTCGCAACCATGCCCAAAACAGTGACACGGCGTTCCTGACAGCGGAAGAGCGCGACTTCATTGCCCGCGAGAGCGCGCTCA
AGGTCATCTCCCTCGAGTTTGGCCCGCTGACGACTAATTGAGCGGCACGATCGTTGCATGCAGTGCAACCGCATTTTTAATCGAGCTTCTCGAAGTCAAA
TCGAAAGTTGAAGTGCATTACGGGCCACCTTCGCGCAACATCGACATACCTCTCATCATCAGTCAGACATTTGAGCAGCTGTACCGGCGGCATCAATCTG
CTACGTGGCAGTCGTCGCCACAACTCGATTCCGTAGCGCTCTACCTACATCCATGGCGATTGCAGCGCGTGTGCGGCGCGTTCTGCGCGTAGGTGTACTG
GCCGCTGCCGTCGTGGCAGCAGCGGCATCAACAACTCAAGCTTCTGTCGCCGACAGCGCTCCCAAGACCTTCCCCAAGGACATGGTCGACTACCTGCAAT
GCCAAGTGTGCCAGACACCGGAGCTCACAGGCAGCGTGCAGGACTCGGCGTGCGACTACGAGACGGTCGACAAGGCCGTGAACGAGCACTTTCACCCGCT
GCTGCACGAGCTGTCGCGCCTCACGTTCTTCCGTTACTTCAAGGTGGACCTTGGAAAGGAGTGCCCCTATCTGCCGTGGCAGGACGACGGCATGTGCGCC
AGCATCGACTGCGCTGTGTGCGAGTGTCCGTCACACGAAATTCCGGCGCCGTGGAGCCAACTGGACCAGCAGGAGACGCAGTCGCGGAACGTTGAGAAGA
CTGGAGAGGCTGGTAAGCCCTGTGACGAGCAGACCGGCGAGAGCACGCTGTCCAAGGTGGAGCGCAAGAACGCGGTAGCCGGTGAGAGCTTCAACGAGTG
GGAAGAGGTCTCGAACGCCAATGTGTGGGCGACTCAGGGCGAGGCGGAGGAAACTATGACGTACATAAACCTGCTAGAAAACCCGGAGAGATACACGGGC
TACAGCGGCGTCCAGGCTGAGCGTATCTGGAAGTCCATTTACGAGGAGAACTGCTTCACGCCGCCCGAAGAGAGCAAGCTGGACGGCATGTGCCTCGAAG
AACGCGTGTACTACCGCCTCATCAGTGGGCTGCAGGCGTCGATCAACACGCACATTGCCCTGACGTACAAGTTCGGCAACAGTTGGGGGATGAATCCTTC
TCTGTTCGTTAACCGAGTTGGCAAGCACCGTGAGCGGCTGCAGAATTTGTACTTCGCTTATCTGTTCGTCATGCGCGCGATCAGCAAGTATCGTCACGAA
CTGCTCGCGTACGACTACAACACTGGTAACGCCGCGGACGACCTTCGTGTGAGAGAAATTCTTCGTCAGCTCCTGTTGGAAGGATCGGACGATGCTAGAG
CATCGGGAGTGTCTTGCCCGGCGTATGCAGAATGCTCGTCTGTGTTGTCTGGGTTTGACGAAAGCGCACTCTTCCGCGTGCAGGCCGACGGACTATCGAT
CGATCAGTTGGTGCAGGCCAAGCAGGAGAAGGAGCAGCTTGAGGTGCAATTCCGCGAGAAGTTCCAGAATGTGAGCCGTATCATGAACTGCGTTACGTGC
GAGAAGTGCCGCCTCTGGGGCAAGCTGCAGACCATGGGACTGGGTACGGCCATTAAAATCCTGCTCGCTGAGGATGTCTCGACAATCCCGAAGCTCCACC
GCAATGAGCTCATCGCGCTCATCAATGTGGCCAACAATCTTTCTCGCAGTGTTGACGGCGTCAAAATGATGCGGGAGCTCGAGTTCATCGAGGCAGTGAA
GCAATTCGGCATCGTTTGTAGCGCCGCCGTGCTGATCGTTTTAGTGCTGATTCTCATCTTCCGCAAGCGCAAGAGTAGAACGCGTGCTCACAAGAAGAAG
CAAGAATAAATCCTTTGCAAGATAAAGAAAGCTTGCCAAGGCCAACAACCAACACATCACATACAAACAAAATACAGTTCATATTGATTCATGCGCAGCT
AACTGTTTGCTACCTACTGACACACCTACGCAACTTCCTCTTGTCTGCACGACACATCCTGGACTTCCTTGTCCCCGCGTTGCTCTCGGCACTGCATGCA
ATACGGCATCACCAAGTGCTTGACAAAGTTCCTCACCTCGCACGTCCGGATGTCTTCGTCAAGCACATCTTTGTCATAACCAATCTGCCACGCGAGATCT
TCGCGCGACGGGTCCGCGGCCAGCTCCTCCAGCAGGTCCACAAAGTGATCAGAGTCCTCCAGGTCCGCGAAGAAGCCCAGTTGCGTGTTCATCTCGCGCC
GGCAATACAGCAGCCGTGCCATCTCGTGCAGATCATACTCGGGGTGGTACTGCAGTCCCCAGAACTCTCCTTTCAAGTATCGCAGGCAAACGCTTTGCAC
CGTAGTGAACGCATTCGTCGCGAGCATCAGCCCGCCGGGTTGGATAACGCGGACCTCGTCCTTGTGGCTGCTGAAGGCATCGAAGATCGACGGCTTGCCT
TCATACATCGGGTGAGCACGCCCCGCCGCATTGAGGCGGATCTTGCGTGCGACCCCCAGCTCTTTGCCGTGCCTGTTCTTCTGCACGACGCCGCCAGCCG
TGGCCACCGCAAGCTGCAGCCCGAAGCAGCTGCCGAACTGAGGGACGCCGTGGGCGAAGCTCTGTCTGGCAAGGTTCATCATCTGCACCACCGATGGGTC
CTCGCGTTCGTGCACTGCCAGGGACGACCCGGACCAGCCGACGCCATGGTACTGAACAAGTCAAGCAAACAATGAAGAAGTGTGAGCTAAGCTGCTACCT
GCAGAGTTCTTCAACCAACATTAGTGTCTACCTTGGTCAGATCTGGGACGACAAAGCCCGGGTCGGCCGGGTACACGAGGTCGTACTCTGCAGAGCGACC
GACGCTGCGCTCCGTGGCTCTGACCAGCATGTTGGCGTAGAGCTGGCCGGCGGTGGTGGCGCCGCCCGCCTCGAGCACGTCTCGGCCCGACTTGACGTAG
CCGTCGACCACGAGGTAGCGGATCTCCGCGTCGTCGCTCGCCGCTGCAGGCGTCGACGTGTGCAGGAGCTTGGGGGCTGGCAGCCAGCGGCCGGGCCGTC
CGGCGCCGCGTGCCAGCAGCAGCTGAGAGCGAGTGGCCACGCGCCTGAGCATCTTGTTGGCTAGTGGGGGTCGGCCGAGCGGGAGAATGCGGCCAGCTCA
TCTTCCTTCGCTGGTGCTGATGACAGACGGCGACGTGGCCATCGAGACCTTGCCCGTCGTGGTTGAATCTGGAGATACCGGTCAGAAGTACGTCAGCAAA
GCCCCGTCATATCCGATAAAGCGAGCGTCCGGTGGCGCTAGACGACGGGATCTGAAAAGCTCATCTTCACTTCTCAACATGCTTCGCCACGCCACGACCC
AGGTACAGCACAGCGCCAGCAACAGGCTGGTACCGTGCATTCATAGACGACCTTAGCTCACTTTTGTGCGCCTCGATGCTGCTGCAGCTCGCAACGACCT
CCCGCCAGGCCGCCAGGCTCTCCTCCCAGCGAGGCTTCGCTGCGTCCGCGTAAGATCCAGCTACTTAGCACTATGCGCATTGGGTTTTTGGATTGGGGAC
TGACCTTCTTGACTCCGTTACTGCTGCTGTTGCAGACTCAAGGTGGACAACCCGTACACGGGTGAGACCTTCTGCGAGGTCGGCTACGACACGAAGGCGG
AGGCGCACGCCAAGCTGGACGCCGCCGTGAAAGCGCAGCTCGACTGGAAGAACGTCCCGCTGAGCGAGCGCCAGGCGCTCTGCACCAAGTGGATCGATGC
GCTCTCGAGCAACGCAGAGTCCATCGCGCACGAAATCTCCGGCATGATGGGCAAACCTGTCCAGCAGGCGCGCAACGAGGTCAACGGCACCATTGACCGA
GCCAAGTAAGAAAACTTCTTCTCGTTTGTGCTGTATTGATCTACCGCTACTGTACTAACAACATTGGTGTGCTTTTGTCGTGACTGCAATGACTGTAGGG
CTCTCATCTACATGTCGAATGAGGCGCTGCGCACGGACTCGTTCCCCGAGGAGAACGGACTGTTCCGTCAGATCACTCACGACCCGGTCGGCGTCGTCTA
CGTGATTGTAGGTGCAGTCTTTGGCTCGATACTGTCACTAGCTGAAGCTAACAGCGTGGAATCGTCGACTTTCGTGGTGACAGGCTCCGTGGAACTACCC
TCTCATGACGGCGGTCAACTCGATCATCCCCGCTGTGCTGGCTGGCAACTCGGTGTTGTTGAAGCACTCACCTCGCACTCCTCTTTGCGGTGAGCACTAC
CAAAAGACATTCGAGCAAGCTGGCTTCCCCAAGAATGTGCTCCAGTCGTCTTTTGTTGAGCACGGCACGGCTGCGGAGATCATTCAGCGCCCGGAGACTG
CGTTCGTATCTTTCACGGGATCTGTCCGCGGGTAAGTTTTGCTTCTTGACTGTGATAACGTTGAGATCGCTATTGATACTTGGACTAACTGTCGATACTG
CTCATCCAAATGTCTACATGCAGCGGGCGCCAGGTTCAGCAGGTGGCATCCCAGCGCTCCATTGATGTGAGTTTGGAGCTCGGCGGAAACGTACGTATAC
ATTATGGTATTTGCGGTTGTGTTCTCTAGCTCTCGTGCTGAAGTGAATTTCGACACGAATGTAGGACGCGGGCTACGTGACTGCTGATGCCGACGCTGAA
GCTGCAGCGGAGGGTCTCGTGGATGGCGTTTGCTACAACGCGGGCCAATCGTGCTGCGGCGTGGAGCGGATCTACGTCCACGAATCCAAGTACGACCAGT
TCTTGGAGAAGGCGAAGAGCTTGTTCGAGGCGTACAACCTGGGCGATCCGACTGATGCGAAGACGTCCATGGGCCCGATGGCGCTTCCTAATGCTCCCGA
GATGCTCGACGCTCACGTGAAGGATGCCGTGGCGAAGGGTGCTATTAAACTGACCGGAAGCGGAATTGTTACCGACGCCGCTGGAAAGGGACGCTTCTAC
TCTCCTACTCTGCTGGCTGGCTGCAACGGCTCCATGGACATCATGGCGGAGGAGTCCTTCGGTCCGATTGTCGGTGTTGAGCGCGTTTCGTCGGACGCCG
AGGCTATCCAGAAGATCAACGACAGCAAGTACGGATTGACGGCATCAATCTTCACCTCGGACCGCGAGCGCGCTATGGCTCTGGGTTCGCAGATCAGCGC
TGGTACGGTATACATGAACCGTTGCGACGTGCTGGACCCGTACCTCCCCTGGACCGGCACTCGCGACTCCGGCAAGGGCATCAGTCTCTCGAAGCACGGT
TTCCGTGGTGTCACGAAGCTGAAATCGGTACGTGTATGTCGCCATTCTGCCTTGTCATGCCCCCACCCTAACTTTATACTCTGTTTGCTTCTTTGTAGTG
GAACTTCCGCGTCTAGATCGGCGTGCGTGCTTGACTGTTGTCATTAGTGTGGAGTTTTGATGCTAAGAAGAAACAGCAAGTTGAACCTCGAATCGTATCC
GTAATAATGCAATCGATTCGCGTGTTAGTGCCCGTTTGAAGTGCATCCATGGTCTTTGTGTATCGCCAGCACTCTCTTATTCTACGCACAGATCCATCAA
GCAAAGCTTCTCGTTCGAGCCCATCACCTGGTGGTGATGATCACCATCATACTGCAAAAAGTTTCGTGTCAAACGACCGTCGACAAAGCTCTACGCAAAG
ATGTCGAACATGTCAAACGCGGGCAATTTGTTTGTATGTTAGAAGTTGGCTTCTCTACTGTTCTTTCCAACACCTACTTGGAACTCGGAAGCTCCTGCCA
TTTACACCTCGCTGGGGCCGCCGAAGGGGTCGACCTGGCCCTCGCTCGTGACGTAGGCCGACGTAATACCACCGTCAACCACAAACGACGTGCCGGTGAT
GTACGACGCGTCGTCGCTGGCAAGGAAGAGCGCGGCCTTGGCCATCTCGGCAGCCTCGCCGAAGCGGCCCATGGGCACGTGGACGAGGCGGCGCTGCTTC
TTCTCCTCCGAGTCCAGGAACTTCTGCAGCAGCTCCGTGTTGAGCGGGCCGGGGCACAGAGCGTTCACGCGAATGTTCTCGCGCGCGTGGATGGTCGCCA
GCTCGCGGGACATGGCGATGACGGCGCCCTTGCTCGACGTGTAGGCGAGCTGCGGCGTGGCAGCGCCCAGGATGCCCACGAACGAGGCCGTGTTGATGAT
GGAGCCGCCGCCGGCGCGACGCATGGCCGGGATGCCGTACTTGCAGCCGAGGAAGACGCCCTTGACGTTGATGTTCATGGTGAGGTCCCACACGTCCTCC
TGCGTGGCGATGGCGTCGTCGTCGGCGCTGTGCATGATGCCGGCGTTGTTGAACAGCACGTTGAGCGCGCCGAACTCCTTCTCGGCCAGGTTCACCATGT
TCTCCACGTCGCGAGCCTTGGACACGTCCGCCTTGACAGGGATGGCGACCGTGTCGGTCTTGCCCAGCTTGCGGAGCTCCTCCTGCACGAGCTGCACGGT
CTCGGCGGCGGCGTCCTCGTTCAGGTCGGCGCACACGACGCCCTTGGCGCCCTGCTTGGCGAACAGGATGGCGGACTTGCGGCCGATGCCGCCGGCAGCG
CCCGTGATCACGGCCACCTGGCCGGCCAGTCGACTTCCGATGACGCTCATGGTGCGGGGGTATGAAGCGGATGCGAGGTGGTGCTCGAGACGACGCACTT
GCGATAGTGAGTGAGGTTGAAGCCTGTCTTTGATTCGGATCGCGGAGGAGTCCTAGGATAGTGTAGTACACACTAATTTAGGGCTGAGGTGATGGGCCAC
GTACGTCACCCGCGATTGATGAGATCCAGCGCGCGGTCCTCATTGAGGAGGACTTCTCAAGGAGAGGGCCTGAAGCTCTGGAGGTCGGACTCCAACCTCC
ATCGGGACCAGCTTCAAGCAGTGCTTGAAGGGTGCTCGGATGGGAGGCACGGCCCTCCCGCCACGTGCCAGGGCGTCACGCAGCGTACATAGGTATTTGT
ATTTGCTCCCGCTGCCATCCTCGAATTGCCCAAAAAGTATGATCAAGGCAACTTCAACTTCGCCGAGCTCAAATACTAAATGTTTGAGTCCGCTGCTCTA
AGCTTGATGCTGCGATCATGTCGAGGTCGAGGTTCATCTTGCCGATGAACAAACAGCGCAAGGCGTTGCTCATTCCCCCCACCAAGCACCAAAGTGATGC
GCTTCTGATCGTCATATACCGCTTCGTGCCGGTGCAATAGCGAGATGAGCCTTGGCAACACAAGTGTCGGTCGGGGAAGCAGCGACCGCGTGCCTTTTGG
GCCCACGCACAACTTCAGTTGCCCCCATCTGCAATCCAATGCTGCATGATGCGCTGGGTGAACCAGTAGGCAGGCCTACTCATGCTCTTCAGATGTCACT
GCGAACGTCCGTAGTGCTAGTCTCAGCGTCTTGGCCGTAAAATGGCAATGGGGACTCGCTCGCTGGGTATGACAACCCCAACGTGGCTCAATATACAATG
TCGACTCGACATCAATGCTGCAGCTCCCTGAGCCAGGCGAGCTCAGCAACTGAGCCTCAGTTGACTCTCTGTAGAGGTCCTCTACATTTACAAAGCAAAG
CAAAGAAAAGAGCAGCCCAGCGTCGCTGGTTTCGAGAGATGACGGGCTTCAAACGGCATCCAAGCCTGCTTGCAAGGGTACATCCTTAGTCACCAACGGC
GAAGTCTCGTTGAATGAGGGCTGCACGTGGGTCTTGCGGGACTATTCCAGTGATGTTGCCGCGGAGCTAGAGCACTGGGCAGCCCATGACTCCGGCCTCG
TCGACAGCTTTTGCCTTACCTTGCAGCGCCAGACGGCAGCCTGAAGACGAGCGCATCCCCTCGTGCGTCACAAGCTGCACACACTTCGGTCCTGACCAGG
GCGCGCGCAAACTACCGAAATTGGTGTCCACCACACTATTCTCGGGGTTATCAGGTGGAAAAGGATCCCGCCGCCGACGCCACTCGCCAACTGCGCGCCA
TGTTGACTCGCTTCGCCCCCCGCCTGCGCCTTCAGTCGCCTGCTGCCGTGCGCGCCTTGAGCTCGGCCGCTCCGGCTGCGTCTCCGCTGAAGGTGCTGGT
TATCGACGGCTACTCGCCCGAGGGCCGCGCCGACCTTGAAGCTGGAGGCGCCAGCACCGCCGGTAAGCTGTACATCGACCTGCTCAACAAGTCGGCGCCT
GCCGGGGTGGAGGTCGCCTCCGACGTGGTCTACCCCGCAGACAGCGACTTCCAGTCGCCGGAGCTGTCCAAGGTGAGCTGCAGCATCATCTACAGTATGT
AGACTTCTAGGACGGAGGACTCACTTCAACTTGTATCCATGCGCAGTACCATGCAGTGGCCTGGACGGGCTGCTCGCTGACCATCCACGACGCCCAGGAC
GTCCGCGTCACCAAGCAGATCGACTTTGCCAAGAAGGTGTTCGAGGAAGGTGAGAGGCTAATAGTAGTCAACAACCTTTGGGCAGACAAGCAATGCTGAT
GCAGAGCGTTCGTGTGTTTGCTGTTGCCAGGCATCCCGCAGTACGGCAGTTGCTGGGCGGCGCAGATCGCTGTGGCTGCTGCTGGCGGCCACTGTGGAGC
GAACCCGCGCGGTCGCGAGATGGGCATCGCGCGCAAGATCGAGCTGTCCCCGGAGGGCCGCGCGCACCCGATGTTCGAGGGCAAGCCGTCGGTCTTCGAC
GCGTTCACGAGCCACAACGACGAGGTGACCCACATGCCGCCTGGAGGACTCGCTCTGGGCGGAAACGACTTCACGAAGGTGCAGGCCGTGGCTGTGCGCC
ACAAGAAGGGCGACTTCTGGGCCGTGCAGTACCACCCGGAGTACGACCTCCATGAGCTCGCACGCCTTACGTACTGCCGCCGGGCGAAACTCGTTGGCTT
GGGATTCTTCGCAGACATGAAGAGTGCCGATCAGTACGTGGACGACCTTGAGAACCTGCACATTGATCCGTCGCGTTACGACATTGCGTGGCGCCTTGGC
CTCGACGCCGACGTCATGGACGAGAACATCCGCCACTGCGAGACGCGCAACTTCATCAAGTATCTTGCGCTTCCCTACAAGGCCGCGATCGAGGGCAAGT
AAGCAGACCATCAAAGAATCATCGAGCTGTGGATCAAGCAAAATAAATGATATAGAAGATGGGATTCAGCTTCGAGATCGAGTGTACGCTGAGACGTACA
CTGTAGAATGGCTAGGACTGCGAACGCGTGGTAGAACGCCGAGCAGCAGTGGTGTTGCGGTGGAAGCTGGGGGCCTTATTCTCCGCCCATCATGTTGTAA
ATAATCCCCGCAACCGTTGCAACGTCGCCCTTGATCGAGCGGTCGTTGTCGTTAAGGGATTCCTCCAAATACTTGATCCCGGTCTCATCGTGCTTGTAGA
AGACCCAATCCGAGAAGATACCGAAGACAGGAGACGCTTGGATGTCTGTGTCTTCGTTATCCGCAATTGCTACGTCCATCAGCACCAAGTCTTCTGACTG
AGCTCGCAGCTGGTCTTCGCGTAGACACACAACGACAACCACCTTACGCTGCTTCCGCGTCAACAGTAGATCCGGCTTCCACCAGCGAGAACCACCTCAT
TCGTGAGCAGTGGCTTCATTTTGGTACTGCAGTTCCCCTCGAGGAGCGTGGCGACAGCACCAAGAATCGTCGTGACGCTATGCTGCAGTCGTCTCACTGC
AGTGGCTCGTTTCGTCGACCCGAAAGCCTTCCCCTCATCCTGCAGCATGGTGACCAGCTTCTCGATGAACGTCTCGTCCAGTTTCTTGACCGGAAACGCC
GCCTTATCCTCTTGCATGAGTGGGTCGTAGATCTTCTCCACATCTTCCCACTCAAGGGAACTGCTGACGACCCCGTGCTGATTGTCATCACCGCGTCTGC
GCTTCCCCGTCATTTTGCCTTGCCTAGCATGTTTGGTTATTTTGGCCAGCACTTGGTTGAGCTGAAGTCGACGGTCGGCAAATGGCGACAATGGATAGCG
CTCCATTGGCAGTGTTAGCGCCGTCGAGGTCGGCGATCCAGACGCCACTGGTTTCTTCAACGGCAACGAAGTCGAGGTTGCTGAGGTGGCTGGCTGACCT
CGACTCGGAAGTGGACGCGCCCTTCGCTCTTGGTGTTGGGGAAGAGCGAGGCGATGGAGCGCGAGTACTTGATCTTGTGCCTGGGAACAGCAGCTGCGTC
CTCCTCAAGAGGCCAAGTGCCGTCTTCGGCCTCCAGAGAGAAAATCTTAATGTCGAGCTTCTTGCAGAGCACTAGAGTGAGTTCGATGTACACTTCGTCC
CGAAGCCTTGCGCCCAGGTCGTCGAAGTTGATGTCTTTCCGTACGAACGCCGCGATAGAGGAATGTCAACCGACCTCGCTGCTCGGAAGGCATGGAAAAG
AATGGTTGCCTAGAGATCAAAGTTGTGCACTTGAGTCCACGAGCGCAAATTCTGAAGTGAGCAACGATATCTCTCAGGTGCAGGCAAAAGAAATCTGGCG
GTGTATGCGGTCATCCAGATAGACTTCAAGTGCAGTACAGATGGTGCAACTTCAAGTTCGGCTAAGCTTGGTGAAGCGACCAAGCAACACAACAACACCT
TGACTACATGTACGAAAGAATGCACTACGTGGATTACGTGGATAGTCGGAAACCAAACGACATGCAAATGTACACGCAGTAGAGCTATCTAGCCACCCAC
AGAGAACCACAGAGAGACGGAGGCGAGGTCATCGGCAACAAGCGCAATGGTAACGTGTTGAGCAGGCGACGAAAGCCCACCGGGGTCCGTTATCTACAGC
ATGCGCTTACTGCTTGCCGCTTTTCTTCTTGGCGGCCTTCTGCATCTTGACAGCCTGCACGTTCACCTTGACGTCGCGGGTGAAGGGCAGGTAGGTGACG
CCGCCCATGAAGGGCACCAGCACCTCCGGGACCTTGACACCGTTCTCGTCCTGGTAGTTCTCTAGGATGCAGCACACCGTACGCGTGGACGCGCAGAGCG
TCGAGTTGAGCATGTGCACGTACTTCTTCTCGCGCTGGTTCTCCTTCTTGACGCCGCAACGGATCTCCATGGCACGCGACTGGAAGTCCGTGCAGTTGGA
GGCGGACACGAGCTCGCGGTACTCCTTGTAGGCGGGGAACCACGCCTCCAGGTCGTACTTCTTGACGGCAGCGTTGTTAAGCTCGCCAGACACGATGTTC
ACCACGCGGTACGGCAGGTTCAGCGACTGGTAGAACTCCTCGGCGTGACGCAGCATCTCCTCGTGCATGGCAACGGAGCTCTCCGGGTCCGTGATGCAGA
ACTGCTCCACCTTGTCAAACTGGTGCACACGGAAGATGCCCCACGTGTCCTTGCCGTGCGAGCCAGCCTCCTTACGGAAGCAGGTGGAGAAGCCGCCGTA
ACGCAGAGGCAGGGAGCTCTCGGTGATCCACTCGCCGCGGTGGTAGCCGCAGATGGGCTGCTCGGAGGTGGCAATGAGGTACTTCTCGTCCTCGCCGATG
ACCTTGTAGAGCTGCTCGTCGAAGTCGTCGAGCTGCGCGACGGCAGCCATGCCCTCCTTGTTCATGAAGAAGGGCGGCTTGAGCATCTTGTACTGGGCCT
TCATGAGGAAGGACGTGGCGTACGACATGAGCGCCTGCTCCAGCAGGAAGCCGTAGCCCGTGAGGAAGTAGGCGCGGTGGCCGGCCACCTGCACGCCGCG
CTCGGGCTCGTAGCCGTCAATGCGGTGCAGCACCTCGTGGTGGAAGTGCAGGCCGTCCTTCTGGATGGGGGCGCCCCACTTCTTGACCACAATGTTTTCG
TCCTCGTTGCTCGAGACGGGCACGGTCGGGTCCACGACGTTGCCGATCTTGGGCAGCTCCTGGTCCACGAGCAGCTTGAGCGCGTCGGCCTCCTTCTTCT
TCTCGGGCAGCTCGGCGGCCAGCGCCTTGCGCTCGTCGCTCAGGGCCTTGAAGTCCTCCTTGGCCTTGCTGAGCTTCTTGATCTCCTGCTGCAGCGCGTT
CATCTTCATGCTAATGGTCTCCACCTCGCCCTGCTTCTTGCGCCACTGCTCGTCCAGCGCGATCACCTTGTCCACGATGTCCACATCCAGGAAGCGCTTC
TTCTGGTCGGCGCGCACGGCGTCCGGGTCGCCGCCACGCTCGGGACGCAGGCGGTTGATATCGATCGGCATCTTGGCGCTTGGCTTGGCTGTGGGGTGCG
TTGCTTTTCCACGTATGCCGGGGAGCGGGAGCCATCGACGGCTCTGTCCCAAACGTTTGGTCGCAAAGTAAACCTAATTTCTGAAAAAAAGAGTCGCATT
TTTGCATTTCATTTTTTATCGAACAGAAATCGGGTCGAGTGGGCGATAAAATTTTTAATACCGCTTTGGGGCTGGGGACTCGATATCCGGGACAGTCGTA
AGAATACGCTGGACCAAACCGAGCGGAAATGACAGGGCTTTCTAGATCCGGCGTTCCAAATTATTTGAGACCCCCAGATTTAGGTTTGATTCAACGTCCT
AATTCATAAAACCACTTCAACTGCGCTTGACGGCTGTTGTCGCCGACGCGCCGCGACGTCGCGATCATAGCAACGTGCCGCGCTGGTGGTGACGTTCTTG
CGTGGCGGCGAAGCGGTCCACCACCGTGTTGGCGTTCGTGGCGCCCTTCGTGAGCGTGGCCAGGTACGAGACCAGCAGCGCGTCGTTGTACTCCTGCGTG
AACGCCGCGTCGAAGTGCTCGGACGTCATCGCCGGCAGCTGGTTGCAAATGCTCGAGATGTGGCGCAGCAGGTTGTGGTCCAGCGGCGCCTCGCCGTTCT
TCATAGCCTGCAAGAAGCGCAGTAGCACGTCCACCTGCCGGTCCAGCATCTTGACGGCGTCTCGGACGTTGCCCAGGTACGGGTGCACTGCACCACGTCA
CAGCAAAGCATCGGATGAGAAACCGCACCCACAACGATACTGACTCAACCCACGTCGGTGCACTTACAGGTAGACTTGCTGGCGTCGCCGATGGGTGCAA
TCTTCGAGATGTGGTCGATAGCGATACCCTCTGTCTCGGACGTGTCGATCTTGAAAGGCGCCTTGACGAAGATCATCTTGGGCACGCCGTTCAGCATGTG
CAGCTCCGACTCGAACAGCGAGATCGGCAGCTTCTTCTTGGTACTCGGACCCTTGGACTCCGGGTCCAAGATCATGAACAGCGGGCTCTCGTTGAACTCC
ATCACCTGCACAACGACGCGAACAAACGTTTGTCACTCACTCAACTATCCAGCAGCACACCTTCAACTCCGCTCTTACCACGCGGTGCACCGCCAGGTCA
CTGGGGAGCACCTTCGCACCCACCGTGTACCAGCCCAGGAGCTCGAAGCCCGGGAAAACTTGCGAGACTACAGACAAAGCACAGCAAAGCAGCGTCAGAA
TCTACGCGGTTGTATGCCAGAGGCGACAGCATCCATCCGCGTACACTGCTGGATGCGCGAGGTGAGGAACTCCTTGTCGATCTGGATCTCTCCGCTGCTG
CCGACGTCGTACTTCATCTCGAACGAGTCGTAGACGTCCACGTCCAGCCCCTTCTGGATGCCGAAGAGCGCGCCGATGACCTGCGGCGCCTCCGTCTGGC
TCAGCTGCGAGTTGCACTTCTGCCGCGTCTGGTGGTCGGCGACGTTCACGATCACGAGCGGGTGGATCTGGATCTGGCGCTCGCCGCCGCCGGCGCCGCT
GTCCTCGCGCTGCACCAGCATCTCCTCGTCCTGCTGCTCGGCGCTCGTCATCTCCGTGTCCTCCATGCGGCGCGAAGCTCCTCCTTCTTCCTCCTTGATG
CGCCTCGACTATCGGTCGATCCTAGAAACGTTGGTGCGTAGCGTGGACGGAACCGTCTTATAGCCTAGCCCAGTCTGAAACAGTGTCTCGATCTATAAAA
CTGTCTTTCCGACTAGGTAGGCTATACGACAGTTCTCGAAATGCCCGTCTCTACACCGTGGTGTAACGATTGTGTACCGCTCTCGTTGTCGGTGTGACGT
TCGGTACGCGCTGACTATTCCGGCCGGTAAAACGATCGCGCTCGTTGAACAGACCCCCAAGGACAGTGCCGCGCTAAACCAAAGCGAACCCCCCCCCTCG
CCTCCGCCGCAGGACGTGCAGCGCGTCGGATCCCTCTGCAGCACCGCGAGCCCAACCGCCAGTCAGTCAGGCCAGCAGCATGAGCGACCAAGTGTCCGAC
GACCTGCTCTGGTCGCTAGACGTACGTGGGAAAGCAACCGCTTGATGGACGCGTTGCAACTAAGCGCCTACTGCGCATTATTAATGGAAAGGACTCTAAC
CCGAGTATGTATGCATGGTACTACGAGCAGAACTTGATCAAGAAGGATGCCGGCGCCGACGTGGAGGCCGACGCGGACCTCGTGCGCGCGAGCTTCTACA
CGCAGGACAACATGCTGGGCTGCTCCATGATCGGCAGCGACCTGGTCTTCGGCCGCCGCGAGTCCGTCAAGCTCGCGCAGGATGACAGCCACGCAATGGG
AGGGTACGGGCGACCCACGGGCTTGATGGGCTACGGCATCGAGGAGGACGAACTGGACGACGACGTGACAATCGAAGAGCGCATTCCCGCCACTTTCAGC
GCCACGCAGCCCAGCAGCAACATCAGCTACCCTCGACACTCGTCGAGCCAGCACAGCTTCAGCGAAGACACGGACAGGTCCTTCTCGTTTGCGTCCGAGG
AGGAGTTCAACATGGGCAACATACCGGCGCCCTCGCCGCATCGGAAACAATCGACGAGACGAATGAGTGATGGCGATCAGGACACATACGAGCAGCGCAT
CGAGGCGTCGCTTGCTGGGTTCATCACCCAGTCGCTGAATATCGAGTCGCGCATGGCCGCGGAGCAGCTCGCGGACCGACCGTTTACGATGAGTGATCTT
GCGCACTTCAACCCGCAGTTCGGACGGGATATTTATCTTAAACGTCTAGGACAGAGTCTGCAGGAGCAGGAAGGCGAAGGGAAGTCCCTCGCTTCGTATC
GAAGGTCTACTCTGCAGCGAATGTCCACGCCGTCGGACATTATTCGGCAGGGGTGGATTTTGAAGCGCGGCGAGGTTGTTCCAAGCTACCGGAAACGCTG
GTTTACGCTGCGTCGGATGCCGCAAGGCCCGATGCTGACGTACGCCAAGGACAACACGGAGGGAGCACCGTCGAAGATTATTGATCTCAGCTCGACATCG
CGCTGCCTCGTCGTCACCGGCAAGAACGCGAAGGAGCACGAATTCAAAGTCATGACATCGGCAGATTCCTCACGACGTGAACACTGCATGGTTGCAGCCT
CTGGCTACGAGATGACGCAGTGGGTGGTTGCGATCCAAGCTGCAATTAACTCGGGAAATTGCTCGACGTTTGATGGGGCGACCGACTTCCAGCAGCTTTG
GCATGAAGCAGGAATCCAGGGTTTTTTAGTTCGTTATGGTGTGCGCAAGTGCAGCTCGCGGAATCGACTTCAAACTCGAGTCCTCGAGCTTAACTTTGCT
GAGCAGACACTCACGAATTCGCGGCGAGGTGAGACGCTTACGACATTTCACTTCACAGACATTCGCGGCATTTCGGCGAGTAGCATACGCTCGAGCGGTG
AGGAGCATGGGATTAGTATCGACTTCCACGGTCGACACCGGTCCTGGCCAATTTTCTTGGATTCTGTGGAGGCTCGAGACGATTTGTTCGCGATCTTGCA
GCGAATTGTGGACAACGTGGTGACTGGCGCGGACCTGGAGAAACGATCTTCTCGCTTGACGCTGAAGACTGGCCATCTCGAGACGAAAAACGCGGGGCCC
CACGCTACGTTGCGCGGCCGGTTGTTTGTCTGTCTTCATGAAAACTGTATCGTATTTTATCCTGCGGACGGAGACACCACAACGCGCCCGTGGTATGTCA
TCGCCTTAAAGGGACTTCGACTGTCGGTCCGAGAGGAAAAGCGGATGCTTTATGTTGGTCGGCTGGCGTTAGGATGCTCGTCTTCTATTGAATGTCGTGC
CTGGTATGATGCCATTTCTGCGGCTATGGTTCTACCTTCAGAGATCATCGAAATCGAGCTGAAGGAGAGAGCGAAGATCCGTGGCGTCTTCCATGCGTGT
GTGTCTCGGCTGCGAAAATTGCTCAAAGCAAAAGTCACGCCCGAAACAAATGGACCGCCGAAAGACCAGAAGACGGTTAACCTGATGATCACCAAGCTGT
GGGAACTCGTGTTCCCGGGTGAACCGTTCACGTCAAACACCGATCCGAAGTGGTTGGAGATTGGCTTCCAAAGAGGAGGCCCGGCGTCTGATCTTCGGTC
CAGCGGTTTGCTTGGACTCTACTGCTTAATCTTCTTTGCTAGCTTTCCTTCTAGCGAGTTCCAGCGAATCCTGAAACGCACGCGGCATGGTGTGAGCGAA
GGCAACATGAAGAATTATCCTCTTGCGATCGCGTGCATCAACGTCGCATCACTTTTGACTGAGATTCTCGGATTGGGTGATGCCGGCACGCACTCCGAGG
GCTGTTCTGTGAAGGCGATGGAGACATACAGTCTTTTTGTCGCTCAGAGCGTCAGCAAGTCGAGATCATCAATTCGACCGAACACATTCTCATCGTCGCG
GCCATTAAGTGAGTATGATTCGTGGGAAGAAATCGTCGATGAGCCGCAGAACCACGTCTTCGAGACTATCTTCTGCCTGCTTTTCCCGGTCCTCGACTCG
CTTTTTGTTGAAATGGGAGCGGTAAGTCGGCTCCTTTTGTATGATCATCGTATCGGTCATTCACAGTTCTAACGTTCTTCTGTTTGCATTTCTCGCTAAT
AGGGATACATGGAGTTCGGCCAAGTCACGATCGCGTTCCGACGCCGAGTAAACGAGATTTTCAACGCCCAGCCAAGGTCACTGAAAGAACTTCAAAATCT
GGCGAGCGAGCCGTGCACAGGTACCCTTGCTGTGCCAACGGTGTTGGCACCTAAGCAGCACAAGATCAGCAAGCTTCGTATGGGCAAGAAAATAGTGTAA
GCGGGTGGTATGTAACCACGACGAAAGTAGCCGAGTTCATCCACCCCACATAGAGATTTTGAATTGCACCGCAATAGAAATGGTATGCAGTTGCAACGCA
TGACTTCCAGCTGTAACACTACACTTTTCTTCACGTCAGGCCACCCCAAACTCCACCACCACCAGTGCCACCAGTGCTATTTGATCGCGGTAGCTGGCTC
GACGGGGTCCGATGCAAATGCAGATGCCGGCCCCTTCCGCGACCCCCGCCTCCACCCCAGCCATGGTGCTGGTGATGCGGAGGTGGCTGTCCACGGTGCC
CGGATCCTCCATGATGCGCGGTCGTCCGAGCCAGGAACCGCTCCCACGAAAGCTTCATCTCACGTAAAAGCTGAACGGATTGCTCTTTTGCACGTTCCAA
AGCCTGCACACACTCGCAAAGGTCAGGAACACGTTTCCAGCATCCGCCCAAGAGTTAAGAAAAACTTACCGCCTCGTTTGTGCTGGTGATCTGGATGTAA
GCTTCTGGCAGTGTGCGTGAAGACACATCCCGGCCTTTGCTCCATTTGCTTAGTGATTGCGGCCACGGCCCGAAGTACCGCAGTTGGGCACATGCAATAG
CCTCGATCTTCTTCAAGTGAATGCCTCTCTCGCCGAGTAACTTTCCGGGAAAATTAAACTTGCGTGATATCAGCGCCTCCGTGTCAACGATGTCATACAC
ATTGACGCGCGCGAAAAGGTGGCCTGACGATACGGTTCCCTCAACGCTGTCACCACTCAATATTGCGTGCTGCAAACCGTTGCTCCCACCACTAATGGTG
CTTCCACTGTCAACTTCTCCCATCTCATCCTGCTCCAATGCCGAAAGTCCAAGCTTCTTCATCTGTCGACCCCTGTCTTCTAAGGCTTTGCCTTCCTCTT
CATTTCCTTGCAGTCGCATACACTTGCCGATTTGCTCTAGTTTATCCAAAGGTTCAGAACAATTTCTTTTAAGCGACAAGTTCAAGTTGTTTTTTTGGAA
CGATCGATAAACTTACCGATACAAAAGCCGACGTCTCGGGTATCTGGGAAAAGCTGCTGGCGGATATCTTGCGCTTTCTTGTAGGCAGCAATTGCCTCTC
CATATCGTTTCTAGGGAGAAGCAAAGATTTCACGGATGCAAGTGGTGACGTTAAAAGTGGACGCTACAACCCCGTTAAGCTGCAAAGTTCGTACCTGGTC
TCGATACACGCGTGCAAGATTGATGAAGATGCGCGCGGCACGGGGACTGATGTCATTAAAGTAACGATCCGTGATCTGTAGAGCTTCCTTGATATTTTCT
TCTGCTCCACGCCAATCTTTCTGTACTCAGAACACAGAGGATAAGCTACACACGAACTAAAAGATACCATGTATAACAGTTCTCGCTTGATACGCACCGT
AAGTCGCTTGAAATTGCCCATGTTGTTCAACGTGGCAGCTGTCTCAAAACTTGCATTACCGAGTCTGCTTCGACGAATCCTTAGTGCTCGCTCATACAGA
CGACCGATTTCTGCCCGCTGGGTTGCTAACTCCGCCTCACTGCCATCCAAACAAAAATGTTAGACCATCCGGATCTTTAGTACTCGTTGCAAGTAGCCGT
CGTACCTCAGTTGCTGCGCTTCAAGCTGGTTGGAGAGATATAGCGCGAGATTATTTAGCGACTGTGCCACCTGAGGGTGATTCTCGCCGAGCGTTATCTC
GCGAATTTTGAGTGATTGGCGATACATGCCAGCGATATTGGGCCCCGCTTCTTCCTCAACGCCTGCACCTGTCGCACCTTTAGTCGCTCCCGAATTCGCA
TCTCTCTGGCTTGGGCTCGTCATGCTTTCGCTACTTGTACTGGATCTGCTCGGGCTTGGACTTGAATTCGAGCGGGCACCTCGCTGAGCACCACCGCCAC
GCCGCCCTCCACTTCTACCTCCTCTTGCATACCGCTCTCGAGATTCGCGGGCATCTTCCCGTAGTGCGGCCGACGGCGATCGACGCTTTCCTCCAGTCGG
GTAGTTCTTGTAGAAGTTTGCAAGATTGTTCAAACTCGTTGCGTATTCCGGGTGATTTTTGCTTAGCACCCGACTGCGCATTTCAAGTGCCCCCTTTAGC
AAGCACTCAGCGTGTTGCAGCAACCAAACGTTGTGGGCTAAGTATCCCCAACGTGTGCTGAGGCAAATGCCAAACTGATTCAATACCTCAGCAACTTGTG
GATGTTCTGACCAGCCCAGCACCTCGCGTTGCAATCGTAATGACTCCAAATAATGGTACTCTGCGGCAACCCAGTCTGTAACATCGCAGCACGCGTAGCC
GAGATCTGTTAGCAGCAGGGCCTCTAGTGCGATAAGCTCTCGGATTCCGACGCATGTGCAGCGATCATGTGCCGCCGCGGAAGCAGCCTGAGGTTGTGGT
TCCTCGAAAGAAGGTAGTTTATCCAGCAGCGACAGCTCACGATCGAACTTGGCCTCTTCCACATCCCACAGCAACGCGGCAGGGTCGTTTTCACGGTTAC
CACAGGTGCAGTGTAGCGAACGAGTCTCTCGTGATAGTTGCAAACACGAGGACACCACCTGAATACGGCGCCGGGGCTCCACACGTGCACGGAAAATAAA
GCGGCAACGCACCACAAGGTTACTATAGAGCAACGCGTCCACAATCGAGGAGTTGCTGAGCCCAGCAAAACCTGCAGGACGCTGACCACTTCCACTACTG
CTGCTATCGCTTGTACTTGGACCAAAGCTACTGCTGTGTCGTTCGATGGTCGGCTTGGGCAGTGCTCCATCACTCACTGAAAATGTTGGTTCGCTATTCG
ATCTCATCGTACTTGTTGAACTGGTAGGCATTTCTCCAATCTGATCACTCACGATATCTTGTTGAACGCGACAGTTGCTCTCGCGCACCTGCTCAATGCT
TTGCAGCGTAAGTTCATGGGCAAGCCGCATTGCAGATTCAATATTTGCTCGCTCCTTGTCAAATAAGGCCAAGGTGCCTTCGAATCGGTAGGCGTGCGAG
GCCTTGGCGACAATCATGCAATAGTAGCGAACAAAACGTCGCTTCCAAGTGAGAAGTAGCTCTTTGCCCAGCGGAATGCTCATTGGAGGGGCGCCCATCG
ATGCCGCCACAAACGATGAACCAGAAGTTGAGGCAGGTGCGCCATCAGCGAAACATTCATCCCCCATTTTTCCAGCTTCCTCCTCGGCAAAAAGCTGCAC
GAGGTTATGCATACGATAACGGTTCGTTTTTGTATCAAACTCCACTAGCGACCACTGGTGAAGTAGTTCAAGAGCAACGCTGGCCGAGGGAACACTCACT
TCTCGAGCTTTTGCCTCCTCGTCGCTCTCTAGATCCAGCAGATCGTAGCTGTCATTTGTCATGGCACCGTCGTTATCGAAACCAAAACCATCCATGTTCG
AAAGCTGAGAACCGAGACTACGCACGGAGGAGGCATCATCATCCCGGCCACGACTTCGGTTGCTCTTGGCGTAAGCATCGGCAGGAAAGTACGAACTTGA
GGAGTTTGATGTGCTCGTTGTTGCGCCAGCGGAACCACTCAGACACGAAGACATCAGGGAATAGCTGCTACTCCCGGCCAATTTCCCAGCAGTATTCTGC
TCCGTTAACACACTGGATAACACTGCTTCAGCAGCTTCAATCTCAAAACTTCCGCGAAAGAATCCAAAGGCCATGAACGCTAGCCTCAGCGGCTCGTCTA
AATGACAAAAAGATGAGCGGATGCAACGGTCCACGCACTCCTTGTGCCCAACTTGGTTGAGTTCCCGGATGGTCTCGAACCGGTGGTCATCGCGCTATAC
AGCATTACAAAAGATTAATACACTTATGTGATTCGCATGTCGGCAGTTTTGAGACCACTCACCTCCAAATATTCGATCATGCGCTCAGGCGTGACCGTCA
TTCGTGCGTTAGCGAGAGCCCGGCCGACCACACGAATAGCTAGGGGGAGACATCCACAGATTCTTGCCAACCGTTCAGCTAGTTTGGCCGAACAGCCAGG
AGCCACGAGGCAGAGCAACTCTGTCTGTACCGTATCGCAATGCGAAGAGTGGTTGAGTAAGTAAGACGTGCCTCAACGACAAAAAAATCAAAGCATGACT
TACCGCCGTGTGCAACGGGAGCTCCGAGATTGAAAGCGAGTATGGTGTGACGCTGGGGATATGCAAATTTCGCCTAGAGGCAAGCAGCAACTTCAAATTT
GGGGCAACCGATATAAGCTGGTGCAGCAGTTCTTCGCCCTTGTTTTCATCCTCATCCAGCAGCTCTTCAACCTTGTCTAGCACCAGCAAACAGTTCTTGG
TCCTGTAGTACATTCAAGCTCCTGTTAGCCATTTCAAACCCCCACTACTGTGATACGCATAAAGTATACAGAACTCACCCTAACTCCGCAAATACTTCTT
CGTTAGTGTCTGCTGCGGGCATCCCAATACTCTGTGCAATGGCATAGCGCACAGTTGAGAGTTTCTGGCCTTCCAGATCCACGTAAAATACACCGTCAGG
AAACATGCGGCGGCTATGCACGAAGTGCGCGACTGAGATAATGAGAGAACTCTTTCCGATTCCTGGAGCACCTAGGCACGCCGTCACGGCGTTTTCGCGT
AGCGACTTGACCATAAGATACGTTTCAGTGTTACGCCCGATGAACTGGCCGTGCATGGACGGAATGTTGGATGGGTACCGGGGCGTGTAGTCCCGCAGCG
AGCCATTTGGGATGTCTCCGAAGAGAACCACGTCATGCGAAGCCGCTCCAAGAAGCAGAAACTTGCTGGACTCGTCGTGCGGGAATGCCAACGCGTGGCC
CTTGCAGCAACACTGAGTAGCACTGTGTTGGGAGTGACGTGAACCATCCCGCATCCATGTGCATGTCGGTTCGTGGAGATGGCTGTGCGTACAAAATACA
AGGAAGTTAGTCTGTACTCGAATACAAACAACAGCAGCAGCAGCAGCAAACAACTTACGCGCAGCAACAAGCAGCTCGTTTCTGGGTAGGAAGAGCGCGC
ACCGCTCCCTTTGCGATCTCGAACGCTGTCGACACAGTGTGCCCATGAAATAGCGACAGGTAAAAATGTTTGGCGAACATCGTCGCCGAGGCGTCCACCA
CGAGAGAATCCGAATGCACCGCCACGACATGAGGGATCCCAGCGTTCAGGAACACAGACGCGACCTTCTGGCTATGACACGCATTGACAAACACAAGCTT
TACATTGCCGTCCAATGGTTTGGGTCCAGCAGCAGCAACAGTCTCGGACGCCGTGCCTCTCTTCATCTCCACGGGTGTCGCGCCGGGCACTTGCCGGTCC
CCAGGCGTGTGACCGGAGAACATCAACTGCCTCAACGCGTCGGGCGTGATGAGGTGCGTGCAGCCGGCTCCATCCTCGAAGCAGAGCGCGGCTCGTTGGC
CCAGTCCGTGGCCGGAGAAGTGCAGCACCGTGCACTTCCACGCCGTCATGAGGCTGCGCAGGATGTCGGCCGTGGCGATGTCGAAGCGCACGTGGATGGC
CTTGTGCTGCACGTCCGTGAGCAGCGAGTTGCTGATCTCGCGGCGCTCCGCCTCTAGGTCCAGCTTCTCCATGGGGTAGATGCGGTGGCGGCTGTCCTTG
ATCACGAGCGGCGCCGCGTGCAGCACCACCAGGTCCAGCGCGTTCTCGTCGCGGGGCAGCCAGGCCTGAGTCGAAGCTGCTGTCGATGACGCGGACGCAT
CACCCGAAGAAGAAGACGGAGAAGGAGAAGACGACGCAATCAGCGCCTGGATGGCCTGCGCGATCCGCACGCGGTCCCCGAAGGCCGCGATGCCCAAGTC
GTCGCGCAGCGCGTTGCGCGTGAGCTCCGGGAGGATGCTGCCCGAGATCTTGTTGGCGGCGAAGAGCTCCACGTGCTCCTGGAAGCCCTGGGCGCCCAGC
CAGCGCCCCACGTCGGCGCACGACCAGGACCTCCAGGCCGCTGTCGCCGGCGCCGCCTCCATGTTTGAAGTGAAGTGGAGCAGGGTAGTCACTAGGCCAT
GAAGTGTACCTATAGGTTAACCTTGTGAAATGTATGGGGATGTATTGAAATGACTGCTATTATTGGTCTCAGAAGCATCAGAAAAAGCATCAGATCTGAG
TCTATAGTTATTGTCCATCCATTATTGCTGCGATGGCGACGCCAGCGGCTGGAGGCAAGAAGCGGCCGCGCGCCGACTTGCTGTCGTCGCTGGACGCGGC
CTTCGCGACTGCGGCGCAGCCTGCAGCGTCCAAGTACACGGCGCAGGCGGCGGCGCAAGCGGCGCCCAAGGGCAACAAGCAGCAGGCCTACCAGCATGCT
AAGCACAAGCGCAAGGACAAGAAGCGCAACAAGGGTGGCAATGCGCGTGGAGGCGGCAAGGACGCGGCCAAGCCAGCGGCTAAGCAGGAGAAACAGAAGG
AGGAGAAGAAAATTGACTCGCTCTACGAGAAGATTGACGCGGAGCTGCTGGCTATTGGGCTGAAGGACTGCTCGCTGGTGAGGAAACTCTGGGATGGCAC
CTAGATCTATCTATTGGAATTGCACTGCCGCTGATGTATGTTGCCCTTTGTGTTGTGTTGTGTTCTCATTGCAGCAACCGAAGGCCAAGATGTTGAACAA
GCCACGGGCGCTGCACGAGACGTTTAAGAATTATCTGGAGTCCGTGACGAAGGGCACGAGGGCTGGTGCCAATGCAGTGGACAGTCTCAAGAATAAGGTG
CTCAGTTTGGACAACCCGATCAAGACGAAGACTACTGAGACAGCCGAGAAAACGATTGCTGCAGAGAGCAGGAAGCAGACGGCGAAGCTGCTGAGTGCGC
GTCGTCGGAGAGAACTTGGCCTGCATCTGCTCAGCGGCAGCATGAAGTACAACGACGCCAAGCAGCTCAACGATATCTGGGCGCGGTATGTGCGTCAGAT
CATCGAGAGCGAGCTGGGCGAAGTACAGGCCGTAACGGAGGAAGCGCAGCGTTCGCGAAATGCGAAGCTGCAGACCAAGCTCAAGTATTTGGATCTCTCC
GGCTGTCCGGTTGAAGGTACGTGAGCTACTTCAGCTCCTCCTAGACAAAGTGACTGTGCTTACAGGACGTTTCTCTCCTCTTATATTGTAGTGGTGCAGT
CGCAAAACCCGTGCAATGTTGGCCTGAGCGGTATCGTCGTCGCGGAGACCCAGCAAGCAGTGCAGATCTGCTGTCCTGCAGCATCAGACGATGAGGATGC
CGACGGTCCCATCCGCAGTACGTATCGTAGTGGCGTTTCAAGTTCATACACATTTTCGTTGCTAATCTCTCTGTTCGGTGCGGTTGCAGCCCTAGTGAAG
GCGGACTCGCGCTTCAAGGTCCGTTTCGACCCCACCCGGACCCTGCTCCTCGACGGAGCTTGGCTCGCGGAGCGAGCTCAAAAGCCGTCAGCTTTAGACT
TTGGCACTTCAACAACACTTCGACGCAATGTAGCCATGTTGTAGAACATGATCTCCTCTTTAAGTGCACCCACTGAAATAAGAGCATAATCTGCTGTATA
AACCGTTGCACCAGCATCATGGGCGGCGGTAGCATCGCCGGTCTGCTGCTGCTGGCCGTGGCCTTCCACGCGCTGTGCGTCCTCAGCATCTTCGACATCT
ACTTCCAGTCGCCCGTGGAGTCTTTCATCCCGAGCGCCAACTACACATCGTCTCCACCGGCCAAGCGCGTCGTCATCTTCACGCTCGACGGTTGTCGTGT
CGACAAGCTCTTCAAGACCGTCGCTCACTACGCAGACCGCTACGACGTCAGCCCTGACAGCTCTGCGACTGCGCAGTTCAGTTCCAATAGTCGCACCCCG
TTCCTGGGAAATGTGATGCGCCATCGCGGCAGCTGGGGCGTCTCGCACAACCACGCACCGACCGAGAGTCGACCGTGTCACGTGGCGCTGACTGCCGGAA
TGTACGAGGACCCGCACGCCGTCACCAAGAGCTGGAGGCGGCATCCAGTGCCCTTCGACTCGGTGTTCAACCAAAGCAGCAACGCCTTCATCTACGGCAA
TAAAGACGTTGCTCCGATGCTGGCGAGGCATGCGCCGCAAGCTACGGAGGAGCACTACACGGCGAGAGAAGAGGTCGACATGGTACGGGAAGACACGACG
CTGCTGGATGTGTGGGCGTATCGGAAAATGAAGGAGCTGTTTGCTCGTGGGACAGAGGCGAAGGACCCGGAGCTCTACAGGAAGCTGCATGACGACAAAC
TGGTGATTTACTGCCATTTCTTGGGCACAGATTTGACGGGGCCGAAATATGGGGCCGATTCGAGGGAATACCTGGAGAATATTGCGGTGGTTGATGAATT
GATCAAGAAGACGGAGAAAATGATCGACGAGTACTATGGAAACGACGGCCGTACTGCGTATGTGGTCAATTCGGACCATGGAATGGATCTGCGTGGAGAT
CATGGTGACTTAGATCCTTCGAAAACCCGAACGGCAATTATTGCGTGGGGTGCAGGTGTGCAGGGGCCCATTACAACAAACAAGCCTGACCGCGGAGGGT
TTGCAATTGACTTACCTACTCAATCAAGAATCGAAGTACAAGCACGATTGAGAGCTCAGGAAAAGGAAGAGGAGATCGCAGCACGCGAATGGGCGTCGAT
GGCAAATTTTACGCGGAAGGACGTTATGCAGACGGACGTGGCTGCGCTGATCAGTGCACTAGCAGGACTTCCTTACCCTCGTAACTCGGTGAGTGTCTTG
CCATTTACATATCTACCCGAGAACAAATACCGCGCTGTCGCCTTGCGTGCAAATGCCGAACAGCTATACCGACATGCGCTGCGAAAGGAGGAAGTGAAGC
GTGCCCATCGAGGTTTGTTTTTTGTGCCATACTCGCCTCTTCACCACCGGGTACTTGATCTTGAGGCCAGGATGGACGAAGCCCTTGACAAGGGTAAGAG
TCATACGATTCATCAAGAGGCTCATCGCGTCGTCGAGGTTTCTAGCCAGGAGATGATTGAAATTTGCCGGAACGCGATCGTGTACTACCAGACGTACGAC
TGGTTGTTTTTGCTGGGATCCGTCGTTCTGGGCTACTTTGGCTTAGCTTTCGTCGTGATTATCGCCTACCTCAATCCTCTAAAGTTTCGGCTGCGGTGGC
TGTTGCTCCATACGATCGACATCAAGCTCGTTGCTGCTGCGGGCGCAGTGATGTGGTGGCGGCTTCTTGCAGATTCACCGCTGACCCACTATCTCTACGG
ACTGTGCCCCCTTGTCTTCTGGAAATTCGCTTGGGGTCAACGCACTACATTATACGCGGCGGTAGTATTTCCTGGACAAGGATCGTGGTGGCAATGGAGT
GCTGGACTTGCATCGATTTTCCTGTGCCTAGAGCTTGTTGTCCTCGGCTACCAGTACCGGCCAAGTTTTAGTCTATTGTTCGTTCTACTTGCGATGTGGC
CGTGGGTCGGTTCTGGTAGAACCCTAAAGTCTGCACGACGTACGCACCTGAAAGAACGTTGGAGGAAGTTGATGTCGTCAAGTTTCTGCTGGTCAGTAAG
TTGTCTTCTCCTCGCTATCTTCCCATGTTTGCCGAGTAATTATGACCAGAGCACGCCTTTCGTAGGAATCGGCGCATTGTTGGTATTAATCTTTGCGTTC
GTCACGATTCGAAGAGTAGCGCCAGCACAAGGGGGAAGTTTCCGATGGAAAACGATACTTGGTTCTGGAGCAACACCGGTGCTGTTTGCAGTTCTCACTT
TTCACTGGACCGACAACTATTTGCAAAACAACGACACCCCTCCATTCACCCTTGTGGTAACAAACTGGGTCGTTGTCATCTTGCCCCCGGCCTGGTTTCT
AATCCACGGGAAATGCCAGAGTAAAGCGAGTGGATTGTGTTCGCCCAACCTAGAAAAAGCTGGTGATCTCGAGCGGCAGCAGCCAGGTGAAGATTCCCCA
AGCTTGTTGGTTATGAGGCTTGTGAAGGTGCAGTTAGCTCTCGCACCAGCTCTCACGTTGCTTAGTTCATCGTACGAGCTTATGTTTTACGTGGCGCTAT
GCAGTGCTCTCGTCAGCTGGCTGTTACTGGAAGTAAAGCGAACTTTTGCTGCAGGAATCTCTACAAGTCGCGAGGTTCAACGAGCTTTGCTGTTGTTGTT
GTTCGCCCAGATTTCGTTCTTTGGCACAAGCAGTGTGGCGGGTATGACCAGTTTTCAACTGCCTTCGACTCGGCGGTTTTTAACAGAACCTGATCCTTCG
GTAGCGCAGGCTCTTGTGGTCCTGAAGCTTTTGATTCCGTTCGTGGTTGTTGGCTGTGCTTTTCGGCTCATCCTCCTCTTGCCCTCGGGAGCAGTATCAT
CAAGAGAAAAGGAGTTGCGGGGGAGTTCTTGCTGGGTCTCGCGCTATTATCTGCTAGCAATCGCTTTTGTCGAGTTGCTGGCTGTGCACTACCTCTTTCT
TGTGAACAATGAAGGCAGCTGGAAGCAGATGGGGAACTCCATCGCGGAATTCTGCATCATCAATGGCCAGGTAGTCCTATTATCGACCATCGTGCTGCTT
GGTTGGGTTTTCGTGAGCGACTTGGAGCCAAATGACAAAGGATACGAATTAGTGGAAGCAGAGGAAGATGATGAGAAGGTTCAATAGAGTAGAACAAGTT
AAAAAAGTAATGCCAAGAAGATGAAATGGAGTTTCTCCTCAAATGACTTTGCTCGCGAAGAACATTATTTGCATGTAACAAGCTGTGCCCAC