Description :
From Genome Similarity Track
Location :
Scaffold_21:123276- 124368
Sequence
1092 bases(100 bases per row)
aagctgatggaacgcagtgggaatgaccaggaacgacctgccagcagtccgtgtccgtcctcgtccagtagtgacgaaagcagtagcagtgctagtagcc
ccagttccgattcaagcgacagttcgaacaattccagtgatagtgaagaggaagccccgccaccgcctgttaattccggcaatggaggtggaggcaatgg
aggagatgacgaaaagaagaaggagggagacggtaataacagtgattccagcagtagcgacagctcagcagatgaaagtgaccaggaagaggacgacgga
gtgatgatcgatacggatgatgaaaaggacaaagtgaacaatgggatcgacccaacggacgacgacttaagtgacgagagtggtggaagctccgatctgg
agaactcgtatccaagactaccttcagctccagtagacacgctgattgcatttcgacagcaagcagcactgaaggagttgcagatgacggagaagctcaa
gaaggaggttatagaagatgctaagcaacgactccaaggccgacagcagtctcagcgctcgaagaagaagaccccgcagtcgaagcgacgacagtcaaag
cagagtgacagaatgtccaacggcacgcaccttgagaggcaccacacgaacggcagcaccggaactgccgatatgaaggaaggtgctgaagatgagtggc
tggtggattgctcctgtggactgaaagagaaaaactatgatgatggaacgtcgatgatccagtgcgatagctgctcgcactgggttcatgcgaaatgtgc
cgacaaacaacccgaagctgtggcccaggagaagtttttgtgcttccaatgcagctggatgttcgattgtgtgtgtgatgttcgccaacgacccaaccac
gacgatggtcagcggatggtagagtgtgagagctgcaaaacatggcagcacacaatgtgtgtggggatccccatgaccgaggagccagcggatgattacc
agtgtccccgatgtgttcggaaagctcgtcggcgtaaatccgcatcgaatggaagtcgaagtcgtgatgatcgacagcgaaagcgacgtcac