Description :
From Genome Similarity Track
Location :
Scaffold_24:123267- 125503
Transcript NameFunction/comments
g4785.t1hypothetical protein

Sequence
2236 bases(100 bases per row)
TGCCAAGACATCGACTCGTCAAGGAAGCTGCGGGTGCATCCTTTGGAAGGTGCCCGGTTGGACCGTTCTAGAAGCACATGGTTATATTCTGAAAGATGTT
ACTGTGAATGACGCTGAGTACTACGGACTTCTGAAAGGTATGACGATGGCTTCCGAACATCATGTCGAAGATCTATTCGTGGTCGGTGACTCCCGGATTG
TTATCCAGCAAGTGCAAGGACTGATCAATTGCAATCAGCCTCACCTGCGAAAGCATCTCGCGGAGGCTAATGTTCTGAAGGTCAAGTTCCGGACGGTAAG
GCTGGCACACCTCAAGAGGGAGTACAATCAAGCCGCCGATTACTTGACTTCCAAGACGTTGCTACTGGGTGAGTCATGGGAAGTCCAAGATGAGAATGAG
CTCTGACACCTGGAAGTCGTGTCTAAAATACCTGAAAAGGTCACGAAGACTGACACTCCAGATGGCAATGACAGTTCCAGTCCAGTGGAACCCGGAAGTT
CTGATGCGAGGGACGCTCAGGAAAGAATAGTGCTTCCTGATGCTGATTCTGCCCCGTTGTCGGCAGCCGCCAGAGTGATGGCAGCCATGAAGAGGTCAGG
CCTTCAAACCACAGAACATCCGGATGGGTCACCAATGGGACCTCTGGAATTCCAGGCGGAAAGATGTCGTCGCATCAAAGTTCATCAGGAAGAAGACGAG
TACTTGTCTGAAATCAAAGACTTCCTGAAGGGCGACGTTGGCCGATTCTCATCCGCAAGATTGCGAAGGTTGCTGACTTTTTTGCGCTCGACACTCGCGA
TATGTTGTACCGACTTGCACGATCTACCCGAGATCGTCCGAGGGATTTTGTGGATGAGCCAAGGCTGGTCGTCCCGAAGTCACTCCGTCCAGATATGCTG
CACTATGCGCACGAAGATTATCAGGGCGGACATCAAGGCATCACCAGAACGCACGAAAAATTGCGTTCGGAATTATATTGGCCTGGTATGTATGCGGACG
TGGAACGCTATGTGAAGGAATGTGTCGATTGTGCCAGCGGCAAGGGACGACCTCCGAATGCTGGTCCGTCGCCTGGAAACATCGAACCCAGATGACCTTT
CGAAGTTGTATCGATGGACTTTGTGACGCACATGCCGGAGTCCGAGCGTGGGAACACCTTTTTACTTTTGTTCCAAGATACGTTTTCCGGATTCGTCATG
TGCAAACCCATGAGTTCGACGACAGCTCAGGACGTAGCGGAAGCTTACGAAGAGTGCGTCTTCCGAAGGTTTGGAGCAAGTTCAATGTTACGTCACGATC
AAGACCCAAGGTTTATGAGCGAGGTGTTTACTCGTTTCCGAGAACGTTTAGGAAGTCGACAGCGCGCCACACTGGCATATCGTCCCCAGGCAAATGGCCA
ACAGGAGCGATCCGTCCAGACGGTGGTCAGGAGCATCCGAGCGTATATTTCGGAAGCGGATCAGAGCGATTGGGACGATCATTCAGAAAGACTCATGTTC
GCTCTGAATACGTCATTCGACGCAACTCGCCTGGACACGCCATTTTATCTGGTTCACGGATGGGATGCCCAAGGGACGTTATCTGCAATGTTGGGTCCGA
AGCCATCAAGCCTTCAGGAGAGAACCGCTTATGAGTGGCGACGAAAGCTTCAACGGGACTACAGCTATGCGAAAGCATGTGCAGAAGACCTACAGAAGAA
AGCTAAGCGTCACCGTTCGGATGCGCAAACGCAGAAGTGGAAAGAACTTTCCGACAGACTGAAGTCCGGATTCGAAGTGGGTGACCTGGTGTGGTTGTAC
ATTCCGAAGGTCCAACCTGGACTGAGCAGAAAGTTGGCCCACATGTGGCATGGCCCCTTCCGAATTGAGGAAGTGCATGATGACTTCAGGGTGAAGCTCA
AGATTGAGGATACCGGATATCGTGTCAACTCTTGGGTGCACATCAGTCGTTTGAAGCCCCGGGCTCTATTTCCAAAACGCCCGAATATGGAGTTGAACGT
GAACGAAGATGACGACTTTGATGCTGCACTACTTCCAGAAGACAGTTGGGAACCGGATGCTGGAAGGGAGGAGTACGAAGTTGAAAAGATTTTGGACTTA
CGTTGTCCAAACGTACTCGTACTTCCAGGCGGCGCCGAGAGTACCTCATCAAGTGGAAAGGCTATGATGAACCCGAGTGGTTACCAGTGACACAACTAAT
CTGTGGTGCCTTACTCTATGAATTCAACCAAGGTGC