Description :
From Genome Similarity Track
Location :
Scaffold_731:12324- 14083
Transcript NameFunction/comments
Phyag_g7751hypothetical protein

Sequence
1759 bases(100 bases per row)
AGACCGTGCCGCACCGATCTGATCACGTCACGTTGCCCTGTAGGGCCTGACTTCGGGgtgcctccttcttctcctctctTTCATGGCAGACTTTACCGAG
TTTCATTGTCGATTTTTCCAAGATGACACCAAGTCGATTCCGGCACACGTCCGCAGTGCTTCTCGCGGCCACTTTGGTGGCCACATCTTCCGCCATTGAT
TTCGGTGGCGAGAATGACATTACGCAGACCGCAGGCACCGTAGCCCCCGACACAACGCAGGGCTCGACCACAGACAATTATGAGTCGACGAACCAGTGGA
CGCAGACCGCTTCGTCATCGAACAATGTGCACACGATGGCCCCCGCTACCCCTTCAACTGTCGGTGGATCTCAGGAATGGACGACTAGCGGAAGCAGCAA
CCAGAACTGGACCCCGACGAgtggtggcagtggcaacCAGGGTTGGACGCCGCCGGCGTCGACGGGTGGTTCCAATTCGTGGACACCCCCGAGCAGCGGA
ACCGGTAACAACGGAGACTACTCGTTGGAATGTAGCGGCTCGGACGATTCACAGACTCCTGAGACGGGCATCAGTCTCGAATGCAGTGGATCGGACGACA
CCGCGGCGTCATCCAATCTTACCCTGACTGTCACCACGGCTCCTACCACGGGTGACCAGACCCAGCCTTCGACGGCCTCTTCGTCGAACACGGCGTCGTC
CGGCGAGTACGGTGACTCGAACCCGACCACGTCGACAACTTCTAGTCAAACGAGCGGCACCGTCGACCAGGGCTCATCGCAGGATACTACCCAGGGTTCC
CACCAAAATGGTGGAACTGTTGACCAAGGTTCGTCGCAGGACACCAACCAGGCATCATCCTCCAACACGGCACAGTCTACCGAGTCCTCGTCGAACACTG
CTCAGTCGACAGCTTCCTCGTCCAACACGGCTTCGTCCGCGACGCAGGAGGGATCGGACGCGACCCAGACGGACAcaaacagcaccaacactgGCGACCA
CGCCACTTTCGGAACGGTGACTTCCAAGTCAGGCGAGTGTGTCATCGGGAACCCCAACAAGTACGTGTCAACTGCCGATATTGATTGGATTTGGACAAAC
CGCATCGGCCCAGACGCACCAACGCGTGATGCCAACTGGAACGTCATGGACaacaagaactggatcaTGGACCACATTGTGGCTAACAAGGGAACGATGA
ACTACTGCGTTCGTTGGGATAGTACTGAAAAGTTGAGCAAGGCCACGGCATCTAAGTTCCAAGCCATGTTGGAGCGTCAATACGCTGCGTGGAACCGTTG
GTTGATCGGATACGACTGCTGGCCGTACAACGAGATCAAGGTTAACATTGTGGGTTTCGCTGTCAAGGAGGCTTCGCTGCTCGACTGGTCCGACGACTCG
CTTGGCACGATCACTGTTGGCGACCTCGACTCGGACGGAGTGCCGCAGTGCGACCAGAAATGCTACCGGTTCTACGACAACGGCGCAGGTTCTTGGTCGG
ATACTAGCGGTTGCAAGGGTGAACCATTTGACATTTCGTTGTGGCCGAAGCAGGGTCTTGAGGGTGGATTCGGTTATGACTGGGGTCAGGAGGTGAACCT
CGAAAATATGCTGTCGACTCTCGACCAGGACCAACTTGTCATTGTTGCCCACGAAATCGGCCACGGTTTTGGTCTGCCGGACTTCTACGTGACGGCGGAC
AAGCCCAACGACCAGTGGCCGAACTGTATCATGATGGCTGGTAGCTCCATGACTGTCAC