Description :
From Genome Similarity Track
Location :
Scaffold_246:12322- 17980
Transcript NameFunction/comments
Phyke_g8143flavodoxin/amb allergen/pectate lyase
Phyke_g8144hypothetical protein PHYSODRAFT_262310
Phyke_g8145hypothetical protein PHYSODRAFT_315046

Sequence
5658 bases(100 bases per row)
GCCCTCTAACAGCAAGACACGAGTCGTTCTCGTCGACAGTTTGAACGCGCTACAGTAACGCATTCAATGCGTTGCCATCGACCACATCGACTCATGTAAA
TGTAATTCGCAGTTTTGCTTCGCTTAGCACAAGACCATCCAAGAACCCAAGTCCAATCTTTGTTTCTACACCATGAAGCTTTTCCGCCCCATTTTCATCG
CGGTGGTagccttcgtcgtcaagtCCGCGGACGCCTTCACAGTTGGGTCGGCCACTGGCCTAGCAGCCGGTACGACGGGTGGGGGCAGCGCTACTGCCGT
GTACCCGACGACAACAAGCCAACTAGAAGCTTATCTCAAGGATTCTGTACCGCGAGTGATCGTCCTGAACCGAAGCTTCGACTTCCGCAATACCGAAGGC
ACCACGACGGAAGCTGGCTGCCGTCCGGACTACACACGTCAATGCATTGCCAAGAACAACGGCTACAAGAGCCAAGATGTGATTCTCCAGAGCGGCGGCA
TGTCCAACACTGGCGGTTGCTCGGATGGCACCAGCGTGACGGTGACCTACGACAACGCAGCCATCACGCCACTAACTGTGACCAGTAACAAGACCATCCG
CGGTATCGGGACGAGCGGCGTGCTCATGGGCAAGGGCCTATGGCTAAACggcgacaacatcatcatcCAGAATATCCACATCACGGAACTGAACCGCCAT
CTCGTCTGGGGGGGTGACGCCCTCTACATTCAAGGCAGCAACGGTGGTTCAACGGCGATGAACAAGATTTGGCTCGACCACATCAAGGTCTCTCGCGTCG
GTCGTCAGTTCTTGACGACGAACGCGGCCAGCGTGTCCACGATGACCATCAGTAACTCCGACTTCGATGGGCGCACTGACTACTCCGCGTCGTGCGACGG
TCGCCACTACTGgtccttcatcttctacGGCAAGAACACCCGCTTCAGCATGGTCAACAACTACATTCATTCGACGTCCGGGCGCTCCCCCAAGCTCGGC
GGTGACAGTAGCGCCAACGTTATTGCCCACATCGCGAACAACTACTGGGCCGACAACTCCGGCCATTCTTTCGAGGTTGGTGCCAACGCGTGGGTTCTCG
CGGAAGGCAACTACTTCGAAGATACGACGCTGCCTTTGGCGTCGGGGAGCGACGGCTACATGTACGCTGCCACTGCTACCACCGAATGTCAGAGCTACTT
GGGTCGTTCGTGTGCGGCGAATGTAGTGGACAACAGCGGCTCGTTCGGTTCGCGGAGCGGCTCCACGGCGTtgtcgaaggtgaaggcgTACTCGGCGATC
TCGGGCTACAGCCCGCGGTCGGCGAAACAGTGGAGCAAGACGGCTACGAACTTCGGTATTGGTGTGCTGAATTAGATGTTGCGACTACAGCTGAGAGGAG
AGTGCAAACTTCATCGTCTTTAAAGTTCAATCGTTAGCGTCAACTCCATTTTGCACATACGCAGATATACTTATATCAAACAACCACCGGCGCAACATTC
GTGAACACCCTTGGACCGATCACAGGAGAGTCTGATCTCCTCTACCTAGTACAATGCTGCATCTCTTGCTTGATTGCATGACAGtagatgcagcagtttt
CCGCAACGCGATGCAGGGTCaaacatcttcttcaccttgtTCGTACAGAAAAATGCGTCAATAAAGATATCGGTCGCACTAGCGCAATTGTCATCGACCA
TCGGCAATCGTGCCTCGAGGATGTGTCGAGTCTGGACAGAGATTCTCTGTTATAGTTGACGTTGTGACAACATCACTCCAGTGCTCGGGTCAAAAGCTTT
GGTGTGTTCAAGGAAGGCTGGACTGGGGTTTGCCAGCTTTCACATTGGCTTCCAGGGCCCTGCCATCGATTTTACGCGGCCCAAACCATCGACCGCCATG
GCCTAAAAAGCACAGCACGCTTCATGACAGGACCGGTGTGGTCGTTGCCACATCACTGGGGCAAACACGTCGTTGTGCGCCTCTAGATAACACCTCCTTC
GTTACTGTAGCCCGAACTCCCGTGGACATCAACCAATACTACACGAAAATCCGCTATGGTATTCATAGGGTCTTGTCGTAGACGCACCACGATAccttgg
agaagaaaaggTAAGTTAACTTACTTGATGCATTCAACTACCTCGCCGTCGATAACGAAACCTTCGGCGTTGCTCGGCTGAATCGGTGGATTTCAGGTAA
ACTTTGATAGCGCTGTGGTGATGCCTCCTGATCTAGATATCCACGAACCTATCGTAGATCGAGCGCTACCGATGGTCGTCAACCGCTTGCTGCCAGCAGG
GCTCTCCAAACACATCACCACATCCGTTGCAGCACTGTTCGTACGAAACAGCAGTGGTCACACGTGCGCGGTTTGGCGCAATCATGCCGTGACTACACGT
AAGATTTGCCTGTGCTGTCCGTGGCACAAGCAGCCAACATCAGAAGTGTTGTCCGGTGAAAGCTGGTCGCACCCCTGCgttcattttttttatgtTCGTC
TTCTGGTTGTAAAGAATGCGGCGGTTCTTTTGTATACTTGTCTAGGCTCGACGTAGTAAGACATTCTTAATAAGAATTAATATGTGCAACAGCTTGTAGC
TAGTGTATCCAATCTTCAACGAATAGGGCGTTCCAGCCGTGCTACGAATTCAGCTGTAGAGCACATGTGGCGATCAACTCAACAGCTCAACAGCTCAACA
GATTGGCGTTGCAGGCGCAATGTATCATGCATTTACCGGTGGGATAGAAAAGGCTGTTCGAGTCTTTGGTTTGCTTTGTGAACCGGCCCCGTAGCGTTGC
GGAGGGGTCTTTACATTTTTACTTTTGACAGCAAGAAGGGTCGTCGACTTCTATTCGCTCCTTAACCATGGTAAAGTTGTTCACGCTACTCGTCGGGCTG
CCCCTCTTGGTTGCTGGGCTCGTTAACGGCTACGCCAACCCCGAGACGTGCACCGGGACGTGCACGAACGCGCACGATCCTTCCATCATCCGACGCGATG
ATGGAACGTATTTCCGCTTTTCCACGGGCAATAAAATCGCTATTCACTCGGCTCCGGCACTAACGGGTCCGTGGGAGTATCTGGGCGCTGCCGTCCCCGA
CGGTTCCAAGATTAACTTAGCGGGCAAAGATGATCTTTGGGTGAGAACAACCTATTTACTGCGGTTTGTTGTGGCAGACAACCGACCCATCTGAAAGCTT
GGGCTTATACTGAACAATAATTACTTCGCTGGTGTTTTCTGATTTTAGGCGCCCGATGTGACCAAGGTCGGAGACACGTACTACTTGTACTACTCGGTGA
GCAGCTTTGGGACGCAGAACTCCGCTATTGGTCTCACTCGATCCAAGACTATGGAGGCGGGCACCTGGACTGACGCAGGGAGCGTAGGGATCACGAGTGA
TTCCTCCAAGAAATATAATGCTATTGATCCGAACCTGTTCCAAGTGGGCAGTCAGTACTACCTCAACTTCGGTAGCTACTGGCAGGACCTCTTCCAGGCG
AAGATGAAGTCCAACCCAACGAAGAATACTGGCGAAACAGCGAACCAATTGGCGTTCCACTCGAACTATGAAGTGGTAGAGGCTGCGTACGAGTTCTCCT
ACAATGGTTACTACtacctcttcttctccaaggGCTCGTGCTGTGGCTACGACAAGACCCGGCCTGCCAAGGGCAAGGAGTACCGCATCCTCGTGTGCCG
TTCTAAGAGTGCGACGTCAGGCTTTGTCGACAAGAACGGAAACGACTGCAGAAACAACGGTGGTACGGTCGTACTCGAGTCTCATGACTACGTTTACGGT
CCGGGCGGCCAAGGAGTGTACAACGACCCGAAAAATGGTCCCGTCATCTACTATCACTATGTGGATACCCGCATCGGGTACGCGGACGGAGACAAGCGTT
TCGGTTGGAACAAACTCGATTTCTCGAGCGGTTGGCCGACGGTGTAAGTCGGCGACAAGCGTGTAAGTGGGCGACAAGCATAGAGAAACGATGGGTTTTC
CATCCGTGAGTTCAAGCGTTGAAGATGTCAGCGAATATCATGCGTTAGATAAATATACTTGTGTCTGGTATTGCTTTGGAATGGTGGTGCTTTCGGTTTT
ATTCGCTGTTGACGTTGTCAACTGTAGCGACCATTCTTGCTGTACCAAATACCTTCAtttggtgtgctgctgctgcatctctAACCTGCTGCTAATGAAC
TCGGTACTACTTGTAGAACATCCGAAGATTATATTATACTCCAGCCACACTTGCTGTTCGAGGCCGCGGCCCTTCTTGATAAAGCCGTGGGCGCTCTTTT
ACCTTAGCGCTGAGAGGTGTAAATCGGCCGATGACCCCTTGGTCGCAGCTAGAGGGACGACGAGAAACGACAGCGGAGAGATTCAGGCGCAGACCGCCGC
CTGCAGCAcgcagcatcgccatctgcGGCACTGTTCCCATGCCCATGGTCGCATTGAGAAGCAATCCCCAACGTGAGACTCCGAGCTTCTTCCACAGCGA
CGGATTATCAGCAGCTCGATGCCACCGGTACGACACTTGTGAGGCATACCCTAGGCTTTTTAGATCCAAGAATGATAACACTCTTTCACGCAGACGTTGA
GATAAGATGCGCTCTCCTAGCTCATGATGTTTCCCCCGTTGGTTCTCTATAGCTGACGCTCTCTGAGCGTCTTCGTTTCCTGCAGCAAATTCGGATTGAG
TTTTCTCGTCTCgggcttcatcttctgcaaCGTCTCTGTAGctgttcttgatcttgaggtCGCACTCTCGGCGGACGAGCAGCCGAACCGCTCGGTACTG
GCCTTTCCTGGCAGCGTAGAACAATGAGGTTTCCTGGTCGCTGTTTTGTGCGTTGATATCTGCCCCACGGTCCAATAAAAGCTCgacaacatgaacatgc
cCATCAAAGCATGCAAGGTGAAGAGGGGTCTCTTGAGATTCGTTGCGAATGTTGGCGCTCCATCCGAAAtcgagcaggagctgcacaacATCCAAATGCC
CCCGCGCTGCAGCATGGTGTAGTGGGGAGTAGCCGAGCTGTGACCCAACATAATTCACGCTTAGAAAACTGCCATCATTGCGTGGAATTCAGGATTAATA
TGTAAAAACTCACCAATCCTTTGCATCGATCTTTATCGACGCCCTGGTGAAGTAGTAGAAATACAGCACGCTGCTTGCCCTTCTCACTGGCAATCAGCAG
TTGCTCGCATATTTTATCACTCTCGGTTCGTAGGAGACTCGTCAATTGACAAGTACCATCCTGTGTCTGCCGTTGTTTCGTCTTCCCACTGCTTATCTTC
CTGTTGTGTGTATTGCAACATCCACTTCCAGGTTCTGTGCTCACGGTCTTGATATTGTGAAGCACCTTCCGCGCTGCCGAGTGCGTTTTTCTTCCTGCAG
AAGTTGAGGGTCGTGCATCTAAACGTTTTTCAATACGCGTCTGCTCGACTGTCATTAGCGTTTACGAACAAGTACGGGGGAGGTGAAGGCGCCTTGGAAG
ACGTAAGTAAATATGGATGTAATGCAGCAAATATAGCTCATTTTTGCAGGAATTTCttaaagttgaagtggattCCTATTTTTACCCAATCACATGAAGA
TACGATAACGATTGGATGAAATGTTGAATCACGTACTTTAACGGACTGTTTTGGTATG