Description :
From Genome Similarity Track
Location :
Scaffold_285:12322- 14891
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_285-snap-gene-0.11Histone-lysine N-methyltransferase
Pytar_ATCC12531maker-par_contig_285-fgenesh-gene-0.7Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_285-snap-gene-0.12Gene of unknown function

Sequence
2569 bases(100 bases per row)
TCTATCTCTGCAAGACGATGCCCACGGCCGATATCCCCGTCCACAAGTGCAACTGCTATGAAGACACGACCACGACCAGCTCTGCAGCGCGTCGCAAAAT
GGCCTCCGCCGAGCCCGCGCCCGCGCCACGCAAGAAGCGTAGCGGCAGCAAGAAGGCGGCGGTCGTCGAGCCACCGGTTGCGCCCAAAATCTACTGCGGT
GAGAGCTGCCACAATCGCATGCTCTTTATCAGCTGCTCGGCCGAGACGTGCTCGGCGCCCGACGCCGCGCAGTGCTCCAACCGCGCGATCAAGCGCCGCG
AGGCCAAGCCCGTGCGCGTCGAGTACGTGTCCGGCCCGGGCTTTGGTCTCTTTGCCGAAGACGTAATTGAGCCGGGCGAGTTTGTGATCGAGTACGTCGG
TGAAGTGATCGACGACCACGAGTGCGAGCGGCGGCTCATCAAGTACCGCGACGAGGGAGAAGAGCACTTCTATATGCTCGAGATCGAAAAGGACGTGGTC
ATTGACGCGCGGTACCGTAGCAACGACGCGCGGTTCATTAACCACAGCTGCGACTCGAACAGCATGACGCAGAAGTGGAACGTCGATGGCGAGTGCCGCA
TTGGTATTTTCGCGCGGCGCCGCATCTTGGCCGGCGAGGAGATCACGATCGACTACAATTTCTCGCACTTTGGGGACCCCATGGACTGCAAGTGCGGCTC
GGTCGCGTGCACGGGCAAGCTCGGGCTCAAGCGCTCGGACATGCAGACCAAGCGCGCGCTCGAGAAGCTCCAGTTGTCGTCGAAAAAGACGTGCGAGATC
TTTGACGCACCGCCGCCCGAAATCAAGCGACCCGTGCAGCTCTCGTCGCTCGCGCTGCTCAAGTCGGCCAAGCTGGATATGCGGTGGCTGAATTCCTATG
GCTTCAAGAAGCGTCGCCTGTTCAAGCGTCAAGAGACCAAGAAGCCAGCGGCGTCGCAACTGGATGCTACGGCATTGGCGTCCTTGGCATCCCACCCAAG
CACCACGACCGCGTCAAGTAGCAGCAGTCCGCTGTCGTCCGAGTGGTCGGCCACGACCGCCGAGGACGTCTCGGTCGCGTCCGAGACCAAGGAGCTACGC
AAGAGTGACTGGTACAACCACTTCCAGCGAGGTGACCACCTCGCCGAGATGCGGTCCATGTCGAGCTTCATTTGCGGCGGCAAGTTCGACTGGACCGACG
ACCTCCAGGACGTCGCCAAGACGAACCAACCGCTTTCGAAACGACCCGTGCGGCTCGTGGGCAAGCGGGTCGGTCTCGCGGACGCGCGCGCGCGTCGGCT
GAATGATTTGTTGGCGTTTGCTAAGGGTGCGTCGCCGTGGAACTCGCGCGTGGCGTCGTCCGCGCGGATCGATCCGGACCGCATCTACCGCTTCATTGAC
GCCATGAAGAACGGCAAGGTCTTCCACAACCAAGACCAGGTACGACCGCAAATCTCTTCTCTGGCGTCCACTGGGTGTTTGGATACTGATTCCCCTCATC
GTGCTCCCGCAGAACGACCTGAACGAAGACGCATGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGGCG
AGCTCATTTGCTGCGACGGCTGCCCGGCCGCGTTCCACCTCAAGTACGTCCGAGTCTCCCGTATTGTGTCACTGGAACCCCTTCAACTGATCGCTTGGGT
TCTTATTTGAGTAGCTGCACAAACCTCATGATGCTGCCGCCCCAGGGTGACCCGTGGTTCTGCGCTGAGTGCAAACGCCGCGCACAGCTCGAGTCGCAAG
TCACCGCCGCGTCGACGGACACCCATGCCGAGCAGGAGACGACGTCTCGTCGCAATCTGCGTGGCCTGGCCACACAGAACGCGACCACCGCCCCGGTCAT
GCCGAGCCTCAAGCGGATCTTCCACCACGCGACGACGACGACCTCGAAAGCAGGGGCGGCGGCCAAGCGCCGGCCGCGAAAGAAGATGAAGACGAGCGAC
AAGGCGTACCGCCTCCTGGAGAACCTGCCGCTGCCGGCGTTTGACTCGGAATAGGAAGACGACGAGTGAGCGCGCCAAGCCACACTGCCTCGTCGACACG
TGGGCTTCCCTCTTCTGTCCACGCCCCTAAGTCTCCATACAAATTCAAATACAGCAAACTGTCTTGTACCACACGGCGTACGATAGTAGTAGTAATTGTA
TTGCGCAGCCTACTGTTCCAAGAGCTTGGCTGGCACAGGGCCTTCGACTTTGTCCTTGAGAAACGCCTCGCTGTCTTCCTTGGCGCGCTGTTATACAAGC
CCCACATAATGTGCATGAGTACCCACGTAGGATCTAATCACTACTGAATCTCCCGTACGTACCTTGATGGCCGTCACGAGCTGCGCGAACGGGCCGCTCG
ACTTGAGCGCGGGCATGGGCACGCCGCCGTCCAGTTTGCCCAGGAACGAGTGGTTCTCGCGCTCCTCGAGCGCCACACTTTCGTACTCGTTCGAGGCTTC
GCTCGCGCTCGGGAAGCTCTCGAATGCGTGGACCGTCTCACCCTTGAAGCGGTAGACCGCCGCCATGCC