Description :
From Genome Similarity Track
Location :
scaffold_30:123209- 125601
Transcript NameFunction/comments
g2274.t1 arginine biosynthesis bifunctional protein argJ, putative
g2275.t1 conserved hypothetical protein

Sequence
2392 bases(100 bases per row)
CAGTCCAGCGCCCCCGCATCCACTCGCAACTGAACAAGTTGTTTGCTCCAATCAAGTTCATGGCGATAATTCACACCTACTCTACGCCAGCTTACGAGCG
GTAGTCGGCATTGATGGCCACGTACTCGTGCGTAAGGTCAATGCCCAGCACTTGAGTCTCCTCTGAACCAACGCCAAGGTCAATCTCCATCTAGTCCAAC
AATGAGAACAGAACAACGTTTAGAATAAGCAACCCATCAGAATACGAAAAGCGCTTACCTCGACAAACTTTCCGTGTGGCGGGAAGTTGTGCGAGCTGGC
ATCGAGGCCGCCACGAGTGGGCTCGATCAGCATCGCATCGCGCATGTGCTCCACAAGCTTGGCCTCAATCTCGTCGTTGAGCACCATCTCACCGTTCTCG
AAGATAATAACGCCACCCATGTGAATCTTCATGCGACGTGTGATATCCACGTCCTTGTGGTGCAAGCCCATGTACTTCCCCACCGCCATGACCAAACGGC
CCACGTTCGGGTCATTGCCAGCGACGGCACACTTCAGGAGAGGCGAATTTACGACCGACTTGCCGACACCCTTCGCCATCTCCTTGGACAGAGCGCCACG
CACGCGCACCCGCATCACGTGGTGTGCACCCTCGCCGTTTCGCACAATATCCTCGCTGAGTCCCAGACACACCTCGTGCAGCGCCTTCTTGAACTCATCT
AGCTGGCTCATGTCGAAGGGGATTTGGTCCGAGGACACGAGAGTCACCGTGTCCGACGTGCTCTGGTCCGTGTCAATGCTGAGAGAGTTGTACGTGTCGC
CAACCACCTCCGTCAGCAGCTGACGCAGCACGTCACGAGGGATCGACAGATCTACATCAAAAGCCACAGAAAAGTCAGTACAAGTCGAACACGTTAATCC
TGAACAGCCAGGACGCACCGGTGAGGATGTAGGACAGCATCGTAGCCATGTTGGGCTCAATCATGCCAGCACCCTTGGCAATGCCGACGATGCGTCCGCC
GCACACGTCCATGGAGCGGATCTTCGGATACAAGTCTGTCAACAAGCAGCAAAACAATCAGTTAACAATCTACGAAACCTCTATAAAAACCAGCTAATGC
TTACCTGTCGTCATGATTCCCTCGGCAGCAGGCAGCACCGAGTCGGACTGCAGGCTGTTGACGAGCTTGGGGAGGTTCTCCACCATGGCTTCCACGGGAA
TGCGCCATCCGATGACGCCCGTGGAGCAGGGCAGCACCTGAGCGCCGCCCTCCAGCCGCAGGTGCTTGGCCAGGCTCTCGCAGACCTCTTCGGCGTCTGC
AACGCCGCCGCCACTGGCGCACACGTTGGAGATCTTGTTGTTGACGAGGATGGCGCCCAGCGTGGGCTCGTGCAGCCGCTTGCGCCCCACGAGCACGGGC
GCCCCGGGGAAGGCGTTCTGCGTGAAGACGGCGGCGAAAAGCGACGTGGGTTGCACAGGCTTGATGAGCGTCAAGGTCATGGTGGCCGGCAGGTGGGGCG
CCTCTCGCGGGATGAAGTCCAGCTTGGTGGTGCCCACGGAGAAGCCCCAGGGCAGGCGGCTTTGGTGCGTCTGCAGGTAGTCGGTGTATTCGTGGCGCGA
TTCGAATACGAACGGGTGGCCGTGGGTGGACAGGCAGCGAGCCTGCAGCAGCGCGCGCGGACGCGAGAGCGATGACATGCGAAGGAGCGACATGGCGACG
AATGCACTCGGGGGGACGCCGCTTTTCGTCTTGTGGGCCAGTGAACCAAAGATCGCCAGATATTAGTCCAAGTACGTGGCCGATTGACGCAAAATTTGGC
CCCAACGTACCAAATCATATAATTTTGCTCCCATCGTCCAATATGATCGACGGAAACGAGTCGGAGGCCGGCTCGGACGCGCCGCCGCCACCTCCGCCGC
CTCCTCCTCCCCCGCAGTCGCGTCCTGCGCAGCCGCTCAAGCCCAAGAAGAAGAAGGACTTCCGAGAGATTCTAACGCTATTCCACGAGGAGGAACAGCC
GGACGCCACCACGACCAAACGCGTCTGGGCGGCGCTGTGGCAGACGACGCTGGCGGAAGCGCAGGACGAGCACAAGCGGCGGCGGCAGCAGGAGCAGCAC
GGACTTAAGCGCAAGAAAGGGGGCGAGCATGACCATACGCCAATGAGAGGAGCGCCAGGATCGCTCTCGAGACACGGCAGCATGGTCCAGGACCACCTCA
AACGAGCACGACAGGTGCAGATTCTATTGCTATGCTTTCCGGGATTTTTAAACGCGTTTTTCACGAATTGTTGTGTTTTTAGGGCTCTTCGGCGAGCACG
GACTCATCCGAGTCCATCAAGGCTGGGAGACTGGGCGGTAGGTTCCCCAAGAACGCCCCGAAGGGGTCCAAACTCCTGCAGAAGTTTGGCGG