Description :
From Genome Similarity Track
Location :
Scaffold_2084:1232- 2753
Transcript NameFunction/comments
Phypl_g14652hypothetical protein PHYSODRAFT_517932
Phypl_g14653Amino Acid/Auxin Permease (AAAP) Family

Sequence
1521 bases(100 bases per row)
GGCGACccggaggcggaggctgccGAGTACCGTGGCGCCAACGCTATCAAGTATGTCATCCTGCGCCTCATTATGATCACGATCCTGGTGATCGCATCGG
TCATCCTGAAGGACCACTTTCACGACTTGGCCGACTTCGCGGGTGCCTCGTGCATCACGGTGAACTCGATCATCCTGCCAatcgtgttcctgctgaagaa
gaagtggaacGTCATGCCGATCTGGGAGAAGGCCCCGGCGCTTACCGTAGTCGTGGTGTGCTTCTGCCTGGGCTGCTACGTGACGTACACGTCGGGCAAG
AACCTGTTCGCtcccagcgacgacgacgcgtccttCCCCTACTGCGCGCCGGAGTTTGAGAACACCGTGTACTACAATTACACGGCGGAGCACGAGAACT
AGGCAGTTAGCTGCTCGGCGATGTAATGGAATCTGATCATGTTTGAAAAACGTATCGACTGCTGGTGTTGATGAAGTCTTGATGGTGAAGTAACCTTCTC
GTACTATaatactacgtagtattgtgctttgcagactTTTTGTCACTTACGCAGGtaattcgtacgaattaACGAGTCCAACTTATCTATAAATCGTACT
TGAGTATGAATTGCTGTAAATCGTGCATGCTGTACTCATACCAATACTGCGCGCAGGTCATCTAATCACGAGCGACAGATCTAATATGAATTAATACCCG
TTTGGCACTTTCAGAAAGTTCCATTTTCCGGCTATAACGTGCTTCAAACACGACTTCGGGAGTTAATTCTCAAATCCTCTATGATATAACACTAAGTACG
AGTAGTAACTATTATAGTGCACTAAATagcaggacaaactggttgcaaagcacaatacatgtGGCATGTAAATCCGGGTAACCCTATTATAGAAGGAGGA
TCTGCGGTGATACAACAAACGTGTTGTATTGGTATATTGTTTCAAACTAACTGTAAAACGCTCATGTGACTGCAAGATCGCTATGACAACAATTTAGTTC
TCGTGCTCCGCCGTGTAGTTGTAGTACACGGTGTTCTCAAACTCCGGCGCGCAGTAGGGGaaggacgcgtcgtcgtcgctgggaGCGAACAGGTTCTTGC
CCGACGTGTACGTCACGTAGCAGCCCAGGCAGAAGCACACCACGACTACGGTAAGCGCCGGGGCCTTCTCCCAGATCGGCATGACgttccacttcttctt
cagcaggaacacgatTGGCAGGATGATCGAGTTCACCGTGATGCACGACGAGCCGACAAAATCCGACAGGTCCGAAAAGTGGTCCTTCAGAAGCACCGAT
GCGATCACCAAGATCACGATAATCACAATACGAAGAATAACGTACTTGATGGTGTTGGCACCACGGTACTCGGCGGCTTCCGCGTCAGGCTCACCGAGAT
GCACGTTCTCGTTGTCGGCGACAGAGATGAATGAGCGCTTGGAAGCACGGGACTCCTTCTCCGAGTGCTCAGCAACATCAGCAGGAGTAGCAGCATCGGC
GTAACTCAGCAAGTTGCTCTC