Description :
From Genome Similarity Track
Location :
Scaffold_1920:1232- 2256
Transcript NameFunction/comments
Phyta_totarag13867hypothetical protein PHYSODRAFT_498916

Sequence
1024 bases(100 bases per row)
TCGAAGCCTGCGTTGGATCTAATGGCgtacagcagcttcttgcgcatCGACTCTTTGTTGGAGTAAGCTggcagcttgagcaggttCATGCACGTGGCAC
TGGACGGCAGCcggtcgtcgtcttcaacacgtACCTGGTGGATACAGATCTGCGGTGCCAACTTCGAGAAGCCCAGTAGAGGTTGGCGAGAGCAACTCGT
GAtgaacttgagcagcgccgcgCGGTCTTCTGCCGTGAAATCCTCCCTCACGATCTCCCAGAACCACTGGATGATCCGTTGAGACGGGTGGTAGCCGCCT
CCATATTGCGTGTGGTGCTCCCAGTCATCGATGTCGATGTTTGTGGCTGTGCCGCCGATGAGCATCTGCAACTCGGCTGGGGCAAACATTTGGATCCATG
TGCCTGGGATCAAGTCACGGAAACCCTTGAGGAACGCGGCACTCTCTATGGATGACAGCACGTTCAGCTTGTAATTTGCCATCAAGTGGATATACCGAAT
CCGGTTCTCGTTCGTGACGGGAATGTTTGCTCCATCAGGCACGAGGTTCCGTGATACCACTTCAccgaactccatctcgctCACACTGAAGGTCAGCGCC
AGGTCTTCCACGTTGCCATCGTAGTGTTTGAGCTGCATAAGTGATTTGTATAGCTCCGGGTCCAACGAATGTAAGTCGTCGATGTAGTTGAACTTGCCTA
GAAGTTTGTTGAGGAAAAACGCAGCAAATTGCGGCTCCACAAGGATGTTTTCGTACACAGCCTTGGCCAGAACTCGTCCGAGGAAGCGGTAGCGGTCTAG
TGCCTCCTTACGCGTGTCCACAATGTATCTCGCACCTGGATTGGGATAAAGGAGGTGCTCGTCCGTTTCCAGGAAGAAGCCGTACTCTGGCGAGAAAGCA
TTCTTCGTCAGGTTGTCCATATACTCCTTGAATACGCCTCCGCCGTCAATGCCAGCCTCCTCTAGCCCTTGCTCGTTAATAAATGTGACCTTGATGCGCG
ACTTGAGGGCTGCAGGAGACATCG