Description :
From Genome Similarity Track
Location :
contig_3:1231952- 1234393
Transcript NameFunction/comments
g1034.t1hypothetical protein L917_00531, partial

Sequence
2441 bases(100 bases per row)
CAGTGCACAAAGCAAGAGAATACCGCTGATATCCAGGTCTGCCGGTCTCCACTCGCCCTCTTGCTCATCGCCTCCGATAGTGTCTTCATTGCTTGAATTG
GCGCATGACGAATTATCTAACGACGCTCTAGCCTCCTCTTTTTGAGCCAGATCCATTTCCAGCAGACCGAGGAACCACGACGCAATCTCCTCCTCCTTAC
ATTCAGGGTCCTCCAGTGCTTTCAGCAAACGCGTATCCGCATGCTCGTATTTCTTCCTCGTTTTGGCGTTGCCCTCCGTCTCGGTATCCTCTTCGTTCTG
GTTGGTGGCCGAACGCTCATCTTCTGGGTCACTCGCAGGGGCACAATTGTTCTCGCCGTCATTCTTCAGTCTTGTAGTGCTTGAATTGGACTCCCTGGAA
GCATCCACTGCTTCGTCGTTATCGTCGCACCGATCAGGGTAGCCGTCAAAATCCGTGTCCAAGATCGCATTGAGCAAGTGCGCGTACCGGACTAGCGTCG
TGTTAGGCGCAGCGCCTTCACGAATCTTTTGTCGGACAAACCTCGCCACACATGCGCGGCGTTCCGTTTCCGCCACTCTATTCGGAGCCTGCACAACAGG
ATTCGAGACTGCTGCCGATCCAACTTCCGGGGAGAGTGGAGGTGCAGGCTCTGATTGTGTTTGGCTCACTCCACACAAATCCATCGCACCTCTGGTGATA
AGCTCAGACCAAACAGCATACGGCTTCTTCGTGACAAACGGGTTCGCTGTACCAACCAAAACCTGGTAGTCCCCTGCTTCGGGGCTTGCTAAAGCTGATC
GAAGCAACACGGTCTTGCCCACACCGATATCACCTTCTAGGATAAAAGCTTAAAACCAATGTTCAAATCGAGTAAAGCCAGCACCTCAGCATTTTGTCAA
TAATGCGATCTACAGAACAGCATTTCATTACTCTCAGGTAACAATGACTACAAACAGGAGGTAAATTCATTATTCCAATAGGAGTCGAAGGGATCATTTG
AAAATTGAGTACGTGGTCTTGGTTCACTCTAAACGTTTCAGTACCGATTACTCTAGGCCTTAGCTTCCGATCCAATCGAATTGAAAGGAAAAGTCTACAC
TAACACTAACACTAACACGACCACGACCACCGCGACGCCGCAGATTGCGGACGCAGCGTCGAACAGCAAACCGATGAGTGCGAGGCACGCGACGAAGCTC
AGCAGGGCCTCGAAGAGCCAGGATCTCTACTGAAGACGCGTTCTGCGTCCACGCTCATGAGAGTGAGTACTTTCCCCGTCGTGAACTGCTGTTTGGCGGC
ACTGGAGAGCCGCAGACTCTTGTGGAAGATGCAGGTCATGCATAACCAGCGACCGCATGCTGGCGCCCGCTCTGGACGAGAGCAAGAAGGTAAAGTTGCG
GCAGCTGATAACCACCACCGAGACGGCGGCCAGGAGCGCCACGAGCGCGTAGCCATTGGCAATCTGGAAGACGTCGACGCGTCCGTTGATCCTATATCGT
GAGACTTGCCACGATTGGTAGAGGGTCGAAATTCTGCACCAGCAAATCGCGATATACGGTTGGGGTCGTGCCATTTTCAATAGTCCTCGCACGTACCGGT
ACGTACGTGTTGTCATACTTGTTGTCGGACGTCGATAGTGATAGACCAGACCTCCGTAATAGTGGCAAAAGCCGGAATGTGTCGTATTAGCTTTATTTCG
GCATCTCCATTATCTCTTTCCGGACTATGCCACTTTGAAGCTATCCTGACTGAGTTTACCAAGCGTTCGTTTAGTTGATCGAACTGTTTATCCTGAAAAA
AAAAACCTCCAGTGGTAAAAGAGGTCAACGCTGTGCGACGGTCGTCCACCCCCACTTGAGAATAGAGAAATCCAACTCGACCGGCACCGTGTTGGCGAAT
ATAATTGCTAGACCATAGCAAAACTGTCGGAGATACGAAAATGTATGTGGCCCTCCCATCCACCATTGAAATTGGTTTCGTAGTTTGCTTTGTCAAGTAC
TGCCTTGACGGAATCGTTTAGCATATTTGCTTAGCACAACTCTCAATGCTCCATCCCACAGCTTCCATTTGAGCTCGATTCCAAAACTTCGTTTGATGAC
AGCGACGAGGGCCCAAAATATCGCCTGTGAACTCACGCGGAGGAATTTGAGCAAGTTCAGACGGGATCACAGGCGGTGCAACATTTTGATCAGCTGCATT
GTTGCTATTCCTTTCTGCTTGTACCAACTCCATCCCTGCAGCTCTGCAGTATGGCGGTTGAACACGCGAATGGGGAACATTCGAAGGATGTTCGGGTTTC
CGGATCGGCGATAGGAGTTTCGAAACTACTTGTATTCAGGTCAGAGTGGGAGGACGAGCGGCTTTTGCGAGAAACAGTTCGCAAAGGCCACAATTCTGTT
CATTCTCGAGTTTTCCTCGCTCCGATAACCCGCCTCTCCAC