Description :
From Genome Similarity Track
Location :
Scaffold_29:1231846- 1232938
Sequence
1092 bases(100 bases per row)
CCAGTAGGGCGCCTCGAACCTACTGACCCTGACCGTTTTGTTTGCTGGTCAGAACGCACAGGCTCGGCATCGACATGCGCAAGCACTGGAGCTGGCGCGC
GGCACTCCGCCGCGCGATGACCGACCTTCCGGCAACGGAAGCAGGCGAGAGAACGACTGTTCCGAGTACCGTTCCGACGCGCTACATGACGCTGACGATT
GCTCCTCGCATCGATGGCGTCGATGTTCATGGGCTCGGGCTCAGATTCCCGAGCTGAAGCGGGCAGCGCGTGAGCGTATGACGCCACAATCACGTAGTTC
TCGCGTAATGCGAGATCAAATGCCTCTTCGAGTGTAGAGGGGTCCGATCTCGTAAGGCAGTAGCGCGTCATACCTTCGTGCATACCGAACACGAACACAT
GAACCTGAGAGGCCATATCGATGGGCTTGGACACGATACACGACGCGAGGTGTCGTGTCTTCTGAATGTAGTCGCACATAGCCATCGTGTCTTGCCGAAG
GGCGAAGAAGTCTGCCCGATTTCGGGATTCATCATGCGGCGGCTCGAACGCGAGCCGAATGTCACTCTGGAGGGTATCCAAAGTGGGGAAGGCGTTGGGC
CGACGATCAACTTGCCGAGGGCCTATTCCTTGGCTTTCCCAGACAGCCGCGATAGGAGGAAGTGGACCTTCGCGGAAGGCGCCTCGATCAATCTCGAGGC
GATGGTGATGTCGATCTCTCGAAACCAGCGATTCAGCGGAAGTCGGTCTTCTCCGGCACCGGAGTAGGTGGACATCTCTAGCTTCACGACGTCATTCGTG
GAGATACGCGAGGGAGTTGACACTCGCCGATTAGCATCAGCGAGATCGCGTTCCATAAATTCTTGTTCCGCAACGCGCTGCTCGTCGGGCGTCGCTGAGC
GCAACAGCGACGTGACAACAGCTTCTCCGGACACCGCCGCGAGGCGGTGGAGAGCTTCCCACTCGATCCGAGTGAGATGGGGGAAAGCAGCGTGGTCGAG
GTCTTGGCGCACGTCGAACTTGGCCGTTGGAAGGACTACAAAGTGCTACCAGGTGTAACGGGCCAGGTATTTACTCCATTACTTGCTTACAC