Description :
From Genome Similarity Track
Location :
scaffold_331:12317- 14048
Transcript NameFunction/comments
Pl_106005hypothetical protein PHYSODRAFT_517245

Sequence
1731 bases(100 bases per row)
GTGAAGATTATGCAGGTGTTTCAGGACAGCGACAAACCCGCGTTAGCTGATACCGTGCTCTCCAGGGAACACCAAGACAGATTTCTCTGTACAGATTTCG
AGAGACAACGCCTTGTCGCGATAGTAGGTTTCCGTGGTATCAAGCACAAAGCCGTCATTCAAGAATAGTTTCATGTAAACGACAAACTGCTTTGAGTGAG
ACTTCTGTTACTTCGTGATGGGTGCATGCCACAGCGGTGGTTCTTGAGCGTACCATCCGTACCAAGTCGCATGAAGGTGAGTCAATGCTGATCTGAACTG
CTTCCCCATAGCTTGATTTTCATTGCATTGATTAGTCTCTGGGTTGTGCCGTTCACATGTTTCTTGCCTAAGGACGTTGAGCTTAGCTTCCAGTGCGTCC
ATGCGAGCATAGTGCAGCTTCACGTGCTCGGTAAAGTGGTTAATGACAGCAGCTTGGTGCCCGATGACCTTTTGTTCTGTGCTTTGTAGCAACGCCTGCT
CAGATGCCTGGCGCGCTTGACGCCTTGCTGTCTTCATAGGGTAACTCAGGGGTTGCGAGGTGCGACGACCATGTAAGTAACTCAACGTGCGAGCATCCGG
TCTCGGTGATACTAACTTGATTCACTTAACTGCAGGTGCTCCAGCGTTCAGACGTTTCAACATCGGGTAGGGGCAGATCACAGTGACCCTGGGAGGTGGG
AATCAAGCTCCTTGTTTGCGAGTCGAACGAACCCATGTTCGTGAGCGCTACATTTGTTTTGGTGCCGTGTCCACGAAATATCTTGCTAACCTTGTGGTTT
GCTTTACCGGTTTTGAAGATACAGTTAAGGCTCTTGTTCATTGTGTTCATGTTCCAGGCAACTCTGTCGAAGATCCACCGTGCTGTGAGCTCACCACTGC
TGTTGGCGTGTTGTGCCCCGACGCGCCGAGGTAAGGGACGTCAGCGCGATAATGACTTCGGCAGCCGCAGCTATGCGGTTGATTACGCGGTCCACCTAGG
AATCGACAGTGAGTGTCTTCTCCACACTAGCAGCCTGTGGAGCGCTGAGTCCAGCTGTGGTCGAGGATCTCCAGGGGTGGGACGTCCGGAGAAAGCGTGA
TCGCAGCGTGGTCATAGTTTATCGATGACGTCGGTTGATGGGGCGGTCTGCATCAGCACCGCCAGTGCCATGGCAAGCTGTGGGAAAATCTCAAATTCGG
TTCCAGTAAACAACGACAGCCCTTGCTCTTCGGATGTCTTCATCCAAATGAAGGGGACGAAGAACACGTTGCCGGTATCTATGGAGATGTTAGGCGTGCG
GAGCAGAGCGAGATCCGAGGCTTTAAGAGTTGGTATCACAGCAACCAAACAGCGCAGTATCTTGGTAGTCACTCGAGCAACTCGCATTAACATACAAATA
CACAAGAATTTTCTTTAAGTCAGCCTTTGTACATGATGGTGCCATGCGTATAAACCACCACCGCTACGCTTCGTGAAAATAGCATCTTCCCCATTTGACG
AGCTTCCAACGCGGCCCGGTGCCGAGGGAATTGGTTAAGGAGCCAGGGTTTGGCCAGCTTGTAAAACTGAATCGCAGTGTTTCGAGCCAAGGTCTTTCCT
TTTTCTCATTAAACGGAAGACATACTTCAAAATTGTCCATTACGGATCAAAAACACTTTCCACTCGCATCTTGCTAAATGCACATACGCGCATACTCGTT
GACACACCTTCGGACTTCACGAAAGACCCCA